Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15587

Chd7 chromodomain helicase DNA binding protein 7 ( MGI:2444748)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587
"Pseudo-wholemount" of euxassay_010758. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010758_01 euxassay_010758_02 euxassay_010758_03 euxassay_010758_04
EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587
euxassay_010758_05 euxassay_010758_06 euxassay_010758_07 euxassay_010758_08 euxassay_010758_09
EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587
euxassay_010758_10 euxassay_010758_11 euxassay_010758_12 euxassay_010758_13 euxassay_010758_14
EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587
euxassay_010758_15 euxassay_010758_16 euxassay_010758_17 euxassay_010758_18 euxassay_010758_19
EMAGE:15587 EMAGE:15587 EMAGE:15587 EMAGE:15587
euxassay_010758_20 euxassay_010758_21 euxassay_010758_22 euxassay_010758_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15587Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15587_wholemount_strong.wlz
15587_wholemount_moderate.wlz
15587_wholemount_weak.wlz
15587_wholemount_possible.wlz
15587_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15587_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 weak expression: see section 03
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 08 09 13 14 15
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 08 09 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 02 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons marginal layer
moderate moderate
regionalmoderate expression: see section 03 05
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 13 14 15 16 17 18 weak expression: see section 11 12 19 20
vomeronasal organ
weak weak
regionalweak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31237
Entity Detected:Chd7, chromodomain helicase DNA binding protein 7 ( MGI:2444748)
Sequence:sense strand is shown

>T31237
CAGGTGGCTGGAGGAGAACCCTGAGTTTGCTGTCGCTCCAGACTGGACCGATATAGTCAAGCAGTCTGGT
TTTGTTCCCGAGTCAATGTTTGACCGTCTCCTCACTGGACCTGTGGTGCGGGGAGAAGGAGCCAGCAGGA
GAGGACGGAGGCCCAAGAGCGAGATCGCCCGAGCAGCCGCGGCGGCTGCTGCTGTCGCCTCTACTTCAGG
GATCAACCCTCTGTTGGTGAACAGCCTGTTTGCTGGGATGGACCTGACAAGCCTTCAGAATCTCCAGAAC
CTCCAGTCCCTCCAGCTGGCAGGGCTCATGGGCTTCCCTCCAGGACTGGCCACAGCTGCCACCGCCGGAG
GCGATGCGAAGAGCCCCGCCGCAGTGCTGCCCCTGATGCTGCCAGGGATGGCGGGCCTGCCCAACGTGTT
CGGCTTGGGCGGGCTGCTGAACAACCCTCTCTCAGCTGCTACTGGAAACACCACTACTGCTTCAAGTCAA
GGAGAGCCAGAGGATGGCACTTCCAAAGCGGAAGAGAAAGGAAACGACAATGAAGACGAGAACCGAGACT
CTGAGAAAAGCACAGACACCGTTTCGGCTGCTGACTCCGCGAACGGATCTGTTGGTGCTGCTACTGCCCC
GGCTGCATTGCCCTCCAACCCGCTGGCCTTCAACCCTTTCCTCCTGTCCACCATGGCCCCAGGCCTCTTC
TACCCATCCATGTTTCTACCTCCAGGACTGGGGGGATTGACACTGCCTGGCTTCCCAGCACTGGCGGGAC
TCCAAAACGCCGTGGGTACCAGCGAAGAAAAGGCTGCTGACAAGGCCGAGGGAGGGCCCTGTAAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4007312), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 54818. Forward Primer - name:054818_F_IRAV48_h02_Chd7, sequence:CAGGTGGCTGGAGGAGAA; Reverse Primer - name:054818_R_SP6_IRAV48_h02_Chd7, sequence:TCTTTACAGGGCCCTCCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15590 same embryo
 EMAGE:15589 same embryo
 EMAGE:15586 same embryo
 EMAGE:15585 same embryo
 EMAGE:15588 same embryo
 EurExpress:euxassay_010758 same experiment
 MGI:4823840 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS