Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15815

2310045N14Rik RIKEN cDNA 2310045N14 gene ( MGI:1924005)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815
"Pseudo-wholemount" of euxassay_013221. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013221_01 euxassay_013221_02 euxassay_013221_03 euxassay_013221_04
EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815
euxassay_013221_05 euxassay_013221_06 euxassay_013221_07 euxassay_013221_08 euxassay_013221_09
EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815
euxassay_013221_10 euxassay_013221_11 euxassay_013221_12 euxassay_013221_13 euxassay_013221_14
EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815
euxassay_013221_15 euxassay_013221_16 euxassay_013221_17 euxassay_013221_18 euxassay_013221_19
EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815 EMAGE:15815
euxassay_013221_20 euxassay_013221_21 euxassay_013221_22 euxassay_013221_23 euxassay_013221_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15815Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15815_wholemount_strong.wlz
15815_wholemount_moderate.wlz
15815_wholemount_weak.wlz
15815_wholemount_possible.wlz
15815_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15815_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 05 20 23 24 weak expression: see section 04
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 17 18 19 20 21 22 weak expression: see section 04
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 08 09 17 18 19 20 21 22 23 weak expression: see section 04 16
shoulder rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 17 18 19
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 21 23 24 weak expression: see section 04
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39572
Entity Detected:2310045N14Rik, RIKEN cDNA 2310045N14 gene ( MGI:1924005)
Sequence:sense strand is shown

>T39572
CCAGAATGACCAATTCTCTTCCGAGAAAGAAAAGATTACCAAACTTAACAAGAAAAATTCAGAGAAGACC
AGTGCATTAGAAGTGCAGAGGAGTTGTGTCATATGTCACGTGGAAAGACAAGACAAGATAGAATTTGTTC
AGAGGAATTCCACAGAGCTAAGAGAGAATGCAGGTGCAAAAGATGCTCCATGCATAGAAAGTCTGGAGAA
ACAAGAAAGCAACAACCTGAGAGATAAACAAGACACTGAAGATAACAATGGAGGAGAAAATGGGATTTCT
TCTAAGGACGATTCCAGAGGAGTAGAAGCTGAGAACAGAGCTTCAGCAGCTGCAAGTGGAGCAGTGCTAG
ACAAACACTCGACTGAAAGCCAGCACACTGAGGACATGAATGGTGACCCGTCCCATGAAAGGTGCATCAG
TAATATAAAGACCACTTCTACACCAGGAATCCTTGGAAATTCAGCATCAGGATCCACTTTCCAGAATGCT
GAACAGACAGAGTCTACTGGCAGCAGTAAGCGCAGGGTGGCAGAGGAGTGCTTCCTCAGTGAGGACAACA
AAAAGAGCAGAATAGATGTAGTGAGAAGAGGGGAAGAGCCCACAGCTAGGACAGAGGAAACCAGGCAAGC
CAGAAGCCTGGGTGATAGACTCCAGGATGGAATGACCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 110377. Forward Primer - name:110377_F_cDNA_LOC238564, sequence:CCAGAATGACCAATTCTCTTCC; Reverse Primer - name:110377_N_SP6_cDNA_LOC238564, sequence:GTGGTCATTCCATCCTGGAGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15817 same embryo
 EMAGE:15816 same embryo
 EMAGE:15820 same embryo
 EMAGE:15818 same embryo
 EMAGE:15819 same embryo
 EurExpress:euxassay_013221 same experiment
 MGI:4822666 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS