Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15970

Iqgap2 IQ motif containing GTPase activating protein 2 ( MGI:2449975)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970
"Pseudo-wholemount" of euxassay_013405. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013405_01 euxassay_013405_02 euxassay_013405_03 euxassay_013405_04
EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970
euxassay_013405_05 euxassay_013405_06 euxassay_013405_07 euxassay_013405_08 euxassay_013405_09
EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970
euxassay_013405_10 euxassay_013405_11 euxassay_013405_12 euxassay_013405_13 euxassay_013405_14
EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970 EMAGE:15970
euxassay_013405_15 euxassay_013405_16 euxassay_013405_17 euxassay_013405_18 euxassay_013405_19
EMAGE:15970
euxassay_013405_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15970Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15970_wholemount_strong.wlz
15970_wholemount_moderate.wlz
15970_wholemount_weak.wlz
15970_wholemount_possible.wlz
15970_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15970_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cervical intervertebral disc
weak weak
regionalweak expression: see section 08
lumbar intervertebral disc
weak weak
regionalweak expression: see section 09 10 11
thoracic intervertebral disc
weak weak
regionalweak expression: see section 08
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 03 05 20
vertebral axis musculature
weak weak
regionalweak expression: see section 01 03 04 05 06 07 08 10 11 12 13 14 15 17 18 19 20
adrenal gland
moderate moderate
regionalmoderate expression: see section 05 06 13 weak expression: see section 04
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 07 09 10 11
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 18 19 weak expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 07 08
pons ventricular layer
weak weak
regionalweak expression: see section 05 06 08 09 10 11 13
midbrain ventricular layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12
esophagus
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 09
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15
stomach
weak weak
regionalweak expression: see section 05 06 07 08 09
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
mandible
weak weak
regionalweak expression: see section 04 07 08 10 13 17 18 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 13 14
upper jaw incisor
weak weak
regionalweak expression: see section 12
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metanephros
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 13
sacral vertebral cartilage condensation
weak weak
regionalweak expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40392
Entity Detected:Iqgap2, IQ motif containing GTPase activating protein 2 ( MGI:2449975)
Sequence:sense strand is shown

>T40392
ACCCACCATTAACAGTAATCCGAAAGTTCGTGTACCTGTTGGACCAGAGTGACTTGGATTTCCAGGAGGA
GCTGGAGGTAGCCAGGCTACGAGAAGAAGTAGTGACGAAGATCAGGGCCAATCAGCAGCTGGAGAAGGAC
TTGAACCTAATGGACATCAAGATTGGACTGCTGGTGAAGAACAGGATTACGCTGGAGGATGTAATCTCAC
ACAGAAAAAAGCTGAATAAGAAAAAAGGTGGTGAAATAGAAATACTGAATAACACTGACAACAAGGGAAT
TAAAAGCTTGAGTAAGGAGAGACGGAAAACACTGGAGACCTACCAGCAACTGTTCTACCTCCTCCAGACC
AAACCTTCATACCTGGCTAAGCTGATTTTCCAGATGCCACAGAACAAGTCGACGAAATTCATGGACACGG
TTATCTTCACTCTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 152727. Forward Primer - name:152727_F_cDNA_TC1412430, sequence:ACCCACCATTAACAGTAATCCG; Reverse Primer - name:152727_N_SP6_cDNA_TC1412430, sequence:TAGAGTGAAGATAACCGTGTCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15968 same embryo
 EMAGE:15969 same embryo
 EMAGE:15967 same embryo
 EMAGE:15966 same embryo
 EMAGE:15971 same embryo
 EurExpress:euxassay_013405 same experiment
 MGI:4825614 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS