Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17774

Kbtbd5 kelch repeat and BTB (POZ) domain containing 5 ( MGI:1919580)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774
"Pseudo-wholemount" of euxassay_008935. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008935_01 euxassay_008935_02 euxassay_008935_03 euxassay_008935_04
EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774
euxassay_008935_05 euxassay_008935_06 euxassay_008935_07 euxassay_008935_08 euxassay_008935_09
EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774
euxassay_008935_10 euxassay_008935_11 euxassay_008935_12 euxassay_008935_13 euxassay_008935_14
EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774
euxassay_008935_15 euxassay_008935_16 euxassay_008935_17 euxassay_008935_18 euxassay_008935_19
EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774 EMAGE:17774
euxassay_008935_20 euxassay_008935_21 euxassay_008935_22 euxassay_008935_23 euxassay_008935_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17774Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17774_wholemount_strong.wlz
17774_wholemount_moderate.wlz
17774_wholemount_weak.wlz
17774_wholemount_possible.wlz
17774_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17774_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 20 21 22 23 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 19 20 21 22
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 24
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04
foot
moderate moderate
regionalmoderate expression: see section 07 08
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 03 04 22 23 24 weak expression: see section 02
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 21 22 23 24
tongue muscle
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 10 11 12
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35475
Entity Detected:Kbtbd5, kelch repeat and BTB (POZ) domain containing 5 ( MGI:1919580)
Sequence:sense strand is shown

>T35475
ACACAGACTTGCTGAGTTCCAGGGAGCCGCACCATGACGCTGGGCTTGGAGCAGGCGGAGGAACAGCGTC
TGTACCAGCAGACGCTCCTGCAAGACGGCCTCAAGGACATGCTGGACCACGGCAAGTTCCTAGACTGTGT
AGTGCGCGTGGGTGAGCGCGAGTTCCCGTGCCACCGCCTGGTGCTAGCCGCCTGTAGCCCCTACTTCCGC
GCGCGCTTCCTGGCTGAGCCAGATAGCGCGGGAGAGGTACGCCTGGAGGAGGTGTCGCCAGACGTAGTGT
CCCAGGTGCTGCACTACCTGTACACATCAGAGATCGCGCTGGATGAGGCAAGCGTGCAAGACCTGTTTGC
CGCGGCGCATCGATTCCAGATCCCGTCCATCTTCACCATCTGCGTGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82321. Forward Primer - name:082321_F_cDNA_Kbtbd5, sequence:ACACAGACTTGCTGAGTTCCAG; Reverse Primer - name:082321_N_SP6_cDNA_Kbtbd5, sequence:GACACGCAGATGGTGAAGATG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17776 same embryo
 EMAGE:17773 same embryo
 EMAGE:17772 same embryo
 EMAGE:17775 same embryo
 EurExpress:euxassay_008935 same experiment
 MGI:4825694 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS