Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17914

Stx7 syntaxin 7 ( MGI:1858210)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914
"Pseudo-wholemount" of euxassay_011674. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011674_01 euxassay_011674_02 euxassay_011674_03 euxassay_011674_04
EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914
euxassay_011674_05 euxassay_011674_06 euxassay_011674_07 euxassay_011674_08 euxassay_011674_09
EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914
euxassay_011674_10 euxassay_011674_11 euxassay_011674_12 euxassay_011674_13 euxassay_011674_14
EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914
euxassay_011674_15 euxassay_011674_16 euxassay_011674_17 euxassay_011674_18 euxassay_011674_19
EMAGE:17914 EMAGE:17914 EMAGE:17914 EMAGE:17914
euxassay_011674_20 euxassay_011674_21 euxassay_011674_22 euxassay_011674_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17914Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17914_wholemount_strong.wlz
17914_wholemount_moderate.wlz
17914_wholemount_weak.wlz
17914_wholemount_possible.wlz
17914_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17914_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forebrain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07
spinal cord
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 14
cervical ganglion
weak weak
regionalweak expression: see section 07 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 13 14 15
neural retina
strong strong
regionalstrong expression: see section 02 03 04 23 moderate expression: see section 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37096
Entity Detected:Stx7, syntaxin 7 ( MGI:1858210)
Sequence:sense strand is shown

>T37096
AGGCTGCTGAGAGAGAGAAAGAGTTCGTTGCTCGAGTGCGAGCCAGCTCCAGGGTATCGGGTGGTTTTCC
TGAAGACAGCTCAAAAGAAAAGAATCTTGTATCCTGGGAAAGCCAAACACAGCCTCAAGTGCAGGTCCAA
GATGAAGAAATCACAGAGGATGACCTCCGACTCATTCATGAGAGAGAGTCTTCAATCAGGCAGCTGGAAG
CTGATATTATGGACATTAATGAAATATTTAAAGACTTGGGGATGATGATTCATGAACAAGGCGATATGAT
TGACAGCATAGAAGCCAATGTAGAAAGTGCGGAAGTTCACGTTCAACAGGCAAACCAGCAGCTGTCAAGA
GCGGCAGACTATCAGCGCAAATCCAGGAAAACTCTCTGCATTATCATTTTTATCCTCGTGGTCGGAATCG
TGATCATCTGTCTCATCGTATGGGGACTGAAAGGCTGAGCCCCGAGGGCGTGGACGACTGCATGATGCTG
TCTGAGCGATGCAGGCAGATTCTTGCGATCACTTTCTCTTATCGTTATCTTGAGGCTGTTGTGTAAAATG
ATGGTTCCATACTTTGCCATTTTTACTAGGGTGGGGGGATTCTTTTTGGATTCAGTCTGATATTTTCTAA
TACCCAAGGCTTTTCTAAACACCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89156. Forward Primer - name:089156_F_cDNA_Stx7, sequence:AGGCTGCTGAGAGAGAGAAAGA; Reverse Primer - name:089156_N_SP6_cDNA_Stx7, sequence:AGGGTGTTTAGAAAAGCCTTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17916 same embryo
 EMAGE:17917 same embryo
 EMAGE:17915 same embryo
 EMAGE:17913 same embryo
 EurExpress:euxassay_011674 same experiment
 MGI:4828529 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS