Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18302

Ccdc148 coiled-coil domain containing 148 ( MGI:3039583)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302
"Pseudo-wholemount" of euxassay_012096. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012096_01 euxassay_012096_02 euxassay_012096_03 euxassay_012096_04
EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302
euxassay_012096_05 euxassay_012096_06 euxassay_012096_07 euxassay_012096_08 euxassay_012096_09
EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302
euxassay_012096_10 euxassay_012096_11 euxassay_012096_12 euxassay_012096_13 euxassay_012096_14
EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302
euxassay_012096_15 euxassay_012096_16 euxassay_012096_17 euxassay_012096_18 euxassay_012096_19
EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302 EMAGE:18302
euxassay_012096_20 euxassay_012096_21 euxassay_012096_22 euxassay_012096_23 euxassay_012096_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18302Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18302_wholemount_strong.wlz
18302_wholemount_moderate.wlz
18302_wholemount_weak.wlz
18302_wholemount_possible.wlz
18302_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18302_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pons mantle layer
weak weak
regionalweak expression: see section 06
facial vii ganglion
weak weak
regionalweak expression: see section 03 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 02 03 04
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08
neural retina
weak weak
regionalweak expression: see section 01
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30715
Entity Detected:Ccdc148, coiled-coil domain containing 148 ( MGI:3039583)
Sequence:sense strand is shown

>T30715
GGCGTCTGGAAGAGCTGAAGAAGTTAATGGCAGAACAGTCAGTGAAAGACAGAGAAAGGGTTAAATATAG
ACAAGAATTGTTGGAGAAGCGTTTGATGGAGAGAAAAAAATTGGCCCTTCAAGAAGTCCAGGAAGAAGAA
GAGAGAGAAAGGCGGCTGGAAGCCCTACGAAAGCAGGTTGCTGTTGCTGTCCAGTCTGACCCAGTTAGAA
TGATGTCAGAGACACTGGCCTGGAAAGCAAGGACAGGCTCTGAAAGTGAGGAAGAATTCATCCTTCAAAA
GCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6417188), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60376. Forward Primer - name:060376_F_IRAV119_f02_BC062650, sequence:GGCGTCTGGAAGAGCTGA; Reverse Primer - name:060376_R_SP6_IRAV119_f02_BC062650, sequence:GCGGCTTTTGAAGGATGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18300 same embryo
 EMAGE:18303 same embryo
 EMAGE:18299 same embryo
 EMAGE:18301 same embryo
 EMAGE:18304 same embryo
 EurExpress:euxassay_012096 same experiment
 MGI:4823669 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS