Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18303

Fbxl17 F-box and leucine-rich repeat protein 17 ( MGI:1354704)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303
"Pseudo-wholemount" of euxassay_012091. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012091_01 euxassay_012091_02 euxassay_012091_03 euxassay_012091_04
EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303
euxassay_012091_05 euxassay_012091_06 euxassay_012091_07 euxassay_012091_08 euxassay_012091_09
EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303
euxassay_012091_10 euxassay_012091_11 euxassay_012091_12 euxassay_012091_13 euxassay_012091_14
EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303
euxassay_012091_15 euxassay_012091_16 euxassay_012091_17 euxassay_012091_18 euxassay_012091_19
EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303 EMAGE:18303
euxassay_012091_20 euxassay_012091_21 euxassay_012091_22 euxassay_012091_23 euxassay_012091_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18303Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18303_wholemount_strong.wlz
18303_wholemount_moderate.wlz
18303_wholemount_weak.wlz
18303_wholemount_possible.wlz
18303_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18303_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 14 15 16 moderate expression: see section 05 06 07 08 09 13 17
ventral grey horn
moderate moderate
single cellmoderate expression: see section 09 10 weak expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30714
Entity Detected:Fbxl17, F-box and leucine-rich repeat protein 17 ( MGI:1354704)
Sequence:sense strand is shown

>T30714
ACCCCCAATATGTCCGCTGCCACCTCCTAACTCTCTTCCTATGCCCAGGTCTACTCAGGCCGGTTCAGCA
GAATGGAGAAATGGGGGGCTCCAATAGGGGGTCTTTCGGAAAGGTTTTAACCGTCACCTGTCAGTGTGTG
TACCCGAGTGTTCCGTTTGTGTCTTGTTTGCATTCTGCATAGCATAAGCGCACTGTTACTTACCCCAAGG
TGAGCTGGCTTGTTTTCCCTAAAACAGAAGATTATGAAAACCAGGACCTTTTTGTTTTTTGTTTTGTTTT
CCAATTCAAACGTCTATTTCTCTAAAAAGACTTTGTGGAATCTCAAGTCAGAAAACTGGTTGTATAGTTT
TGAGCTTTTAAGTTCTGACACATCTCGGAAATGCTCGCAGAAAGGCTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6810624), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 63344. Forward Primer - name:063344_F_IRAV119_e11_Fbxl17, sequence:ACCCCCAATATGTCCGCT; Reverse Primer - name:063344_R_SP6_IRAV119_e11_Fbxl17, sequence:CAAAGCCTTTCTGCGAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18300 same embryo
 EMAGE:18299 same embryo
 EMAGE:18302 same embryo
 EMAGE:18301 same embryo
 EMAGE:18304 same embryo
 EurExpress:euxassay_012091 same experiment
 MGI:4824796 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS