Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18410

Zcchc6 zinc finger, CCHC domain containing 6 ( MGI:2387179)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410
"Pseudo-wholemount" of euxassay_014361. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014361_01 euxassay_014361_02 euxassay_014361_03 euxassay_014361_04
EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410
euxassay_014361_05 euxassay_014361_06 euxassay_014361_07 euxassay_014361_08 euxassay_014361_09
EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410
euxassay_014361_10 euxassay_014361_11 euxassay_014361_12 euxassay_014361_13 euxassay_014361_14
EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410
euxassay_014361_15 euxassay_014361_16 euxassay_014361_17 euxassay_014361_18 euxassay_014361_19
EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410 EMAGE:18410
euxassay_014361_20 euxassay_014361_21 euxassay_014361_22 euxassay_014361_23 euxassay_014361_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18410Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18410_wholemount_strong.wlz
18410_wholemount_moderate.wlz
18410_wholemount_weak.wlz
18410_wholemount_possible.wlz
18410_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18410_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 10 11 14 15 17 18 moderate expression: see section 01 02 03 04 05 06 07 08 09 16 19 20 21 22 23
radius
strong strong
regionalstrong expression: see section 01 23 24
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 20 21 22 23 24 moderate expression: see section 05
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02
forelimb digit 3 metacarpal
moderate moderate
regionalmoderate expression: see section 24
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 24
forelimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 24
carpus
strong strong
regionalstrong expression: see section 02
foot
strong strong
regionalstrong expression: see section 07 11 12
fibula
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 03 04
tibia
strong strong
regionalstrong expression: see section 01 05 moderate expression: see section 03 04
femur
strong strong
regionalstrong expression: see section 01 05 06 07 17 19 20 21 22 moderate expression: see section 02 03 04 18 23
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 15 16 17 18 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
hyoid
moderate moderate
regionalmoderate expression: see section 09 13 14 weak expression: see section 10 11 15
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
axial skeleton
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 17 moderate expression: see section 07 08 09 16
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 09 10 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 04 05 06 07 08 11 12
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 13 14 15 16 17 moderate expression: see section 08 11 12
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 18 19 20 21 22 23 moderate expression: see section 04 05
vault of skull
strong strong
regionalstrong expression: see section 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 08 17 18 19 20 21 22 23 24 moderate expression: see section 04
clavicle
moderate moderate
regionalmoderate expression: see section 06 07 16 18 19
scapula
strong strong
regionalstrong expression: see section 02 03 04 20 21 22 23 moderate expression: see section 05
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 09 15 moderate expression: see section 08 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31521
Entity Detected:Zcchc6, zinc finger, CCHC domain containing 6 ( MGI:2387179)
Sequence:sense strand is shown

>T31521
AACTGGCCCCAAATGACAGGTGCTGCCGAATTTGTGGGAAAATCGGGCACTTCATGAAGGACTGTCCCAT
GAGGAGGAAAGTGAGGCGACGGAGAGACCAGGAAGATACCCCAAACCAAAGGTACTCTGAGAGCAAAGAA
AAAAGAAGCAAAGAGGACAAAGAGATTCAGAACAAGTACACAGAAAAGGAAGTGTCAACAAAAGAAGATA
AGCTCACACCGTGTGCAGCTGCGAAAGCCAAGCCAGTGAGGGCAGCTGTCGACCTGGGCCGGGAGAAGCT
CCTCAGGACGCCCACAGAAAAGTGGAAGAGACAGGACGACAGAGACTCGAGAGAAAAGCGTTGTTTCATC
TGTGGAAGAGAAGGACACATTAAAAAGGAATGCCCACAGTTCAAAGGCTCTCCAGGTAGCCTTTCCAGTA
AATATATGACTCAGGGGAGAGCCTCAGTGAAGAGGACCCAGCAGGAATCATGAGGGAAGGAACTGCAGCA
CTGGAAATGCCACTCAGGTGTCCGTGGCCACTTGGGAAATTAGGTTCATGGCACAGGACACAGTGACACA
GATCAGGCTTCAACGTAACAGTTGAGGGGCATCGTAATTTTTTAAATTTTAATGAAATTGTTAATAAGGA
AAAGAAAAATTTTAATATAGTCTAACTATACCACCAATCTCCAGAGATTTGAAGATTTTAATAGAAAGTC
AACTTAAAAGAAAAATATGAGGGCCAGAATTCAATGACTACAGCGTCATGGATTTTAGTTCTTTCAAAGC
ACTCTAAAAATAGTGTGCTGCTCACCAGAGGAGTTAGCCCTCTTTCCCTACACATCCCCTTTTTGATTTC
CAAGAGGGGATTCTCTCTGTTGTTCCTGGATCGTGGTATGGACG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5354757), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31839. Forward Primer - name:031839_F_IRAV67-70_B09_Zcchc6, sequence:AACTGGCCCCAAATGACA; Reverse Primer - name:031839_R_SP6_IRAV67-70_B09_Zcchc6, sequence:GCGTCCATACCACGATCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18409 same embryo
 EMAGE:18411 same embryo
 EurExpress:euxassay_014361 same experiment
 MGI:4829276 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS