Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18411

Caly calcyon neuron-specific vesicular protein ( MGI:1915816)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411
"Pseudo-wholemount" of euxassay_014371. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014371_01 euxassay_014371_02 euxassay_014371_03 euxassay_014371_04
EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411
euxassay_014371_05 euxassay_014371_06 euxassay_014371_07 euxassay_014371_08 euxassay_014371_09
EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411
euxassay_014371_10 euxassay_014371_11 euxassay_014371_12 euxassay_014371_13 euxassay_014371_14
EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411
euxassay_014371_15 euxassay_014371_16 euxassay_014371_17 euxassay_014371_18 euxassay_014371_19
EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411 EMAGE:18411
euxassay_014371_20 euxassay_014371_21 euxassay_014371_22 euxassay_014371_23 euxassay_014371_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18411Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18411_wholemount_strong.wlz
18411_wholemount_moderate.wlz
18411_wholemount_weak.wlz
18411_wholemount_possible.wlz
18411_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18411_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 09 10 13 14 moderate expression: see section 01 02 03 04 05 06 07 08 11 15 16
radius
strong strong
regionalstrong expression: see section 01 moderate expression: see section 24
ulna
moderate moderate
regionalmoderate expression: see section 24
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 20 21 22 23 24
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 02 03
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 02 03
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 06 11 moderate expression: see section 12
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 11 moderate expression: see section 12
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 11
fibula
strong strong
regionalstrong expression: see section 01 02 03 04
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 05
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 17 moderate expression: see section 18 19 20 21 22
brain
strong strong
regionalstrong expression: see section 05 06 09 13 14 15 18 19 20 21 22 23 24 moderate expression: see section 01 02 03 10 11 12 17 weak expression: see section 04 07 08 16
spinal cord
strong strong
regionalstrong expression: see section 09 13 14 15 moderate expression: see section 10 11 12
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 09 15 16
nasal septum
strong strong
regionalstrong expression: see section 12
viscerocranium
strong strong
regionalExpression in the turbinate bone.
meckel's cartilage
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
axial skeleton
strong strong
regionalstrong expression: see section 09 10 12 13 14 moderate expression: see section 06 07 08 11 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 09 10 13 14 21 22 moderate expression: see section 04 08 11 12 15 16
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 13 14 21 22 moderate expression: see section 11 12 15 16
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 05 21 22 moderate expression: see section 04
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 21 22 moderate expression: see section 08
scapula
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 20 21 22
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 07 09 15 16 moderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31834
Entity Detected:Caly, calcyon neuron-specific vesicular protein ( MGI:1915816)
Sequence:sense strand is shown

>T31834
TGGGACGAGGACCATCATCCACCATGGTGAAGCTAGGCTGCAGCTTCTCAGGGAAGCCAGGCAAGGAAGC
AGGAGACCAGGATGGGGCTGCCATGGACAGCGTCCCTCTGATCAGCCCCCTGGATGTCAGCCAGCTTCAG
CCGTCATTCTCAGACCAGGTGGTCATCAACACACAGACAGAATATCAACTTACCTCTGCAGACCAGCCAA
AGAAGTTTGCAGATTTGGAGGGTCAGAGGCTGGCTTGCAGTCACTCAGAGGAAGGACGCAGACTGCCCAC
CGCAAGGATGATCGCTTTTGCTATGGCACTTCTGGGCTGTGTGCTGATCATGTACAAGGCCATCTGGTAT
GACCAGTTTACCTGCCCAGATGGCTTCCTACTTCGGCACAAGATCTGCACCCCACTGACCCTGGAGATGT
ACTACACCGAGATGGACCCCGAACGCCACCGCAGCATCCTGGCAGCCATCGGGGCCTACCCACTGAGCCG
CAAACACGGCACTGAGATGCCCGCTGTCTGGGGAAACAACTACCGGACCGCCAAGGAGGAGCATAAGGGC
ACTACCCCTGCGGCGATGGCTGTGTCCACTGCAGCTGCAGCTGCAGCGGCAGAGGGCACCGAGCCGTCAG
GGAAGTCTTTGGACACGAGAGAGAAAGAAGACCCGCAGAAGGCGGAGGGCGTGCCATCCCAGCCCCCCAA
GTGACTGTCTGCCCCGTCCCCGCTCCGCCCGTGACTGGGCATCCCTCACCAGCTACTTTGACATGCACAC
TGCCTGACGCTTCTCCACCCAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6532801), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61055. Forward Primer - name:061055_F_IRAW1_e02_Drd1ip, sequence:TGGGACGAGGACCATCAT; Reverse Primer - name:061055_R_SP6_IRAW1_e02_Drd1ip, sequence:CACTGGGTGGAGAAGCGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18410 same embryo
 EMAGE:18409 same embryo
 EurExpress:euxassay_014371 same experiment
 MGI:4823598 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS