Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18848

Wdr78 WD repeat domain 78 ( MGI:2385328)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848
"Pseudo-wholemount" of euxassay_014122. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014122_01 euxassay_014122_02 euxassay_014122_03 euxassay_014122_04
EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848
euxassay_014122_05 euxassay_014122_06 euxassay_014122_07 euxassay_014122_08 euxassay_014122_09
EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848
euxassay_014122_10 euxassay_014122_11 euxassay_014122_12 euxassay_014122_13 euxassay_014122_14
EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848
euxassay_014122_15 euxassay_014122_16 euxassay_014122_17 euxassay_014122_18 euxassay_014122_19
EMAGE:18848 EMAGE:18848 EMAGE:18848 EMAGE:18848
euxassay_014122_20 euxassay_014122_21 euxassay_014122_22 euxassay_014122_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18848Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18848_wholemount_strong.wlz
18848_wholemount_moderate.wlz
18848_wholemount_weak.wlz
18848_wholemount_possible.wlz
18848_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18848_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon roof plate
strong strong
regionalstrong expression: see section 11 12
choroid invagination
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 13 14 15 16 17
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 10 11
metencephalon floor plate
strong strong
regionalstrong expression: see section 11
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2409
Entity Detected:Wdr78, WD repeat domain 78 ( MGI:2385328)
Sequence:sense strand is shown

>T2409
TGGCCTCGAGCCAGATTCGGCACGAGGCAGAACTCAGTGCTCCCCACTTAAACCTGAGCCTGAAACTACA
GAACTTTGTCCCACCGATTGGCAAGCTACAGGACAGAACAACAGATATAAGCATCACATATGCTGGCTAG
CCAGCATCCCACTTATCTGTCAGCAGGGGAACAATAATCCGAAATGCATTGCTAGCTTCCTCTCAAAGGA
CCAGAGTCATCTGCAGAGTCAAATGCATTGAGGCCAGACTTAAATTGTCTTAGAAAGAAAACAGAAGGTC
TCAGACATACAGACCAGGTCAGGGTGTTTTCTAAAGTAGTCTAGACAGAGACTGGGCAGTAAGGGTGGGT
ATACACCCACACACACACAACCCCCCACACACACCCACACAGACTTGGAAGGGGTTATCCATGTGGGTCA
CCCTAACTAGTGTTCAGGTGTTGAATGGGGCCATAGGGCGTGACAGCCTTTTCTGTAAGGTGTTTTGAGT
GGAGGAAAGAAGCCAGGGTGTGTAAATTTCACAAAAAATTTGGAGATCT
Notes:The probe template was PCR amplified from IMAGE:1225839 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1225839 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18849 same embryo
 EMAGE:18846 same embryo
 EMAGE:18850 same embryo
 EMAGE:18847 same embryo
 EurExpress:euxassay_014122 same experiment
 MGI:4829208 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS