Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18942

Ndrg4 N-myc downstream regulated gene 4 ( MGI:2384590)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942
"Pseudo-wholemount" of euxassay_015917. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015917_01 euxassay_015917_02 euxassay_015917_03 euxassay_015917_04
EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942
euxassay_015917_05 euxassay_015917_06 euxassay_015917_07 euxassay_015917_08 euxassay_015917_09
EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942
euxassay_015917_10 euxassay_015917_11 euxassay_015917_12 euxassay_015917_13 euxassay_015917_14
EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942 EMAGE:18942
euxassay_015917_15 euxassay_015917_16 euxassay_015917_17 euxassay_015917_18 euxassay_015917_19
EMAGE:18942 EMAGE:18942 EMAGE:18942
euxassay_015917_20 euxassay_015917_21 euxassay_015917_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18942Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18942_wholemount_strong.wlz
18942_wholemount_moderate.wlz
18942_wholemount_weak.wlz
18942_wholemount_possible.wlz
18942_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18942_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
head mesenchyme
moderate moderate
regionalmoderate expression: see section 21 22
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 weak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 05 06 11 12 13 14 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 05 06 14 15 16 17 18 19
pons mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 15 moderate expression: see section 04 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19 20
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 15 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 07
ventral grey horn
strong strong
regionalstrong expression: see section 07 moderate expression: see section 08 09 10 11 weak expression: see section 12 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 13 14 15 moderate expression: see section 08 09 10
neural retina
weak weak
regionalweak expression: see section 01 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63155
Entity Detected:Ndrg4, N-myc downstream regulated gene 4 ( MGI:2384590)
Sequence:sense strand is shown

>T63155
ACAGTACTGAAGAAAGCCCAGCCCAGCCCCTGGATCTGGCAGATGTGAGGTTTGAAGATGGTGGGTAGTG
AGCTAAAGCTCTGATGTGAGTGGGAGTCAGACCAGTGGGCAGCCTTGGACCTTAAGAGTGTCCCTTTCCT
GTAACCCTTGCATCAAGCACACCTATTCTAATAGTAGAAGTGACAGTCATGAGGATGGTAGCCACAAGAG
GGCGCTCTAGACAGACAGCCATTTTCCTGGTGCTCTCTGGGCAGGACAGGTGGTGTAAGGCCAGCCAGGC
TGAAGAATATGGAGAACCCTGACATGGGGGCAGGAACCCCCATACCCTGCCACCACAGGGCCTTGTCCCA
CCCTGAGGCAAAGGTCACCTGGTCTCTTGTCCCTGTTGGCAGAGGTTAAAATGTTGATTGCTGTGTATGC
TGTGTGTAGCCCCTGAGAACTTCATGATTACCCATCCCTTTGGAAGCTGGCAGGTACTGTAGGTCCCTCT
TGTCCCAGATTTCACCAAGTATTTGTCACAGTGCCCTGGTCAACTTGGGCCAGTGTGTCACAGACAATAC
T
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92709. Forward Primer - name:092709_F_cDNA_Ndrg4, sequence:ACAGTACTGAAGAAAGCCCAGC; Reverse Primer - name:092709_N_SP6_cDNA_Ndrg4, sequence:AGTATTGTCTGTGACACACTGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18944 same embryo
 EMAGE:18945 same embryo
 EMAGE:18943 same embryo
 EurExpress:euxassay_015917 same experiment
 MGI:4826634 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS