Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19293

1810055G02Rik RIKEN cDNA 1810055G02 gene ( MGI:1919306)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293
"Pseudo-wholemount" of euxassay_001949. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001949_01 euxassay_001949_02 euxassay_001949_03 euxassay_001949_04
EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293
euxassay_001949_05 euxassay_001949_06 euxassay_001949_07 euxassay_001949_08 euxassay_001949_09
EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293
euxassay_001949_10 euxassay_001949_11 euxassay_001949_12 euxassay_001949_13 euxassay_001949_14
EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293
euxassay_001949_15 euxassay_001949_16 euxassay_001949_17 euxassay_001949_18 euxassay_001949_19
EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293 EMAGE:19293
euxassay_001949_20 euxassay_001949_21 euxassay_001949_22 euxassay_001949_23 euxassay_001949_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19293Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19293_wholemount_strong.wlz
19293_wholemount_moderate.wlz
19293_wholemount_weak.wlz
19293_wholemount_possible.wlz
19293_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19293_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
head mesenchyme
weak weak
regionalweak expression: see section 05 06 07 08 09 10 19 20 21 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 17 18 moderate expression: see section 06 08 15 16
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 07 08 09 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 moderate expression: see section 17
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 moderate expression: see section 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 07 13
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 15 16 17 18 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 18 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 20 21
renal cortex
moderate moderate
homogeneousmoderate expression: see section 05 06 weak expression: see section 07 08 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T725
Entity Detected:1810055G02Rik, RIKEN cDNA 1810055G02 gene ( MGI:1919306)
Sequence:sense strand is shown

>T725
TCCTCGAGNCTGTTGGCCTACTGGGAGCTAACTGGGTTTCGCTGCGGTCCACGTCCCCGCGCGGGGCTGA
ATCGCTGAAGTGGCTGCGCTGCGGTGTGAGGGCCACGGGCCTGCCGCGTCCGGTGTTGCCTCTCTCAACC
GTAGCTGTTTCTGATACCACAGAGGGGCATCTGCCCCTGTCCCACCTGTGCCTTGGCGAATGCCATGGCC
TGGGAGTGCCCTGCCCAGCCGCTCTCATCTGCAAAGCCAGACTTCATATGGCAAGGACAGGATGCCAAGG
CCCCAGCTGCTCAAGGAGGACATCAGCCTGGCCTCCCAGTCTGCACTGAGCAGCTGTCGCTGATCCCTGG
GCCGAGCAGAAGGCGATTGCTGACAGCCTGAAGGGCTGTCTGGCCAAGACACTCAGCCCTGCTTCCAACT
CACCCAGCAAGATGTGGACAGCCCTGGTGCTGGTGTGGATTTCCTCTGTGCTCTTACCTAGAAGCCATAT
GATGTCTGCAGAGCCACGAAACATAGTCACTAACAAGTGGCCTAAAGCAGTAAATCAAAGCATGCTG
Notes:The probe template was PCR amplified from IMAGE:1890250 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890250 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19294 same embryo
 EMAGE:19292 same embryo
 EMAGE:19290 same embryo
 EMAGE:19291 same embryo
 EurExpress:euxassay_001949 same experiment
 MGI:4822642 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS