Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19325

Brp44l brain protein 44-like ( MGI:1915240)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325
"Pseudo-wholemount" of euxassay_002046. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002046_01 euxassay_002046_02 euxassay_002046_03 euxassay_002046_04
EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325
euxassay_002046_05 euxassay_002046_06 euxassay_002046_07 euxassay_002046_08 euxassay_002046_09
EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325
euxassay_002046_10 euxassay_002046_11 euxassay_002046_12 euxassay_002046_13 euxassay_002046_14
EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325
euxassay_002046_15 euxassay_002046_16 euxassay_002046_17 euxassay_002046_18 euxassay_002046_19
EMAGE:19325 EMAGE:19325 EMAGE:19325 EMAGE:19325
euxassay_002046_20 euxassay_002046_21 euxassay_002046_22 euxassay_002046_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19325Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19325_wholemount_strong.wlz
19325_wholemount_moderate.wlz
19325_wholemount_weak.wlz
19325_wholemount_possible.wlz
19325_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19325_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
homogeneousstrong expression: see section 04 05 10 11 12 13
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 08 09 weak expression: see section 06 07 10 11
brain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 16 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 13 14 weak expression: see section 03
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 15 16 17 18 19
spinal cord
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 12
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 10 11 weak expression: see section 03
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 weak expression: see section 08 09 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4600
Entity Detected:Brp44l, brain protein 44-like ( MGI:1915240)
Sequence:sense strand is shown

>T4600
CATCTGTCTAGGTAGCGGCTTCACCGCCAACGCCACGGCCATGGCTGGAGCGCTGGTGCGCAAAGCGGCG
GACTATGTCCGGAGCAAGGACTTCCGGGACTATCTCATGAGTACGCACTTCTGGGGCCCAGTTGCCAACT
GGGGTCTCCCCATTGCTGCTATCAATGACATGAAGAAATCTCCAGAGATTATCAGTGGGCGGATGACTTT
CGCCCTCTGTTGCTATTCTCTGACATTCATGAGATTTGCCTACAAGGTACAACCTCGAAACTGGCTTTTG
TTTGCATGCCATGTAACAAACGAAGTAGCTCAGCTCATTCAGGGAGGACGACTTATCAACTACGAGATGA
GTAAGCGGCCATCTGCATAGCAGTACAAGGACCAGCTCTTGAAAGAGACAGTGCTCCAGCCACTGCTGCA
GCCACAGATCATGTCAGCATGAGTAGTCGTGCTGAAGGGAAAACACAGAATGCTATCTTAATGACCATGC
CAACATTATTGAATAGCCGAGAGTCCCTAAACCCACTCTCTGCTGCCTTATCAATGCTAAACCTTATTTG
TCTTCATCAAGAGTAGTTCAAAATATGCAACTAATTTAATAATTTTGAATGATGGTTTTATCTATAGCAA
TCTGTAGTAATATGTATATTATCTATTGGGATTTGTGTAATAAAAAATCTAAGGGAACAAAATTTTATAA
CTACAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4988147 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4988147 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19329 same embryo
 EMAGE:19330 same embryo
 EMAGE:19328 same embryo
 EMAGE:19327 same embryo
 EMAGE:19326 same embryo
 EurExpress:euxassay_002046 same experiment
 MGI:4823505 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS