Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19771

Pik3ip1 phosphoinositide-3-kinase interacting protein 1 ( MGI:1917016)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771
"Pseudo-wholemount" of euxassay_006239. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006239_01 euxassay_006239_02 euxassay_006239_03 euxassay_006239_04
EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771
euxassay_006239_05 euxassay_006239_06 euxassay_006239_07 euxassay_006239_08 euxassay_006239_09
EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771
euxassay_006239_10 euxassay_006239_11 euxassay_006239_12 euxassay_006239_13 euxassay_006239_14
EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771
euxassay_006239_15 euxassay_006239_16 euxassay_006239_17 euxassay_006239_18 euxassay_006239_19
EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771 EMAGE:19771
euxassay_006239_20 euxassay_006239_21 euxassay_006239_22 euxassay_006239_23 euxassay_006239_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19771Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19771_wholemount_strong.wlz
19771_wholemount_moderate.wlz
19771_wholemount_weak.wlz
19771_wholemount_possible.wlz
19771_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19771_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 weak expression: see section 06 07 08 09 10
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 weak expression: see section 01 02 03 04 05 06 07 08 09 10
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 weak expression: see section 02 03 04 05 06 07 08 09 10
midbrain meninges
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 weak expression: see section 03 04 05 06 07 08 09 10
oral epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2494
Entity Detected:Pik3ip1, phosphoinositide-3-kinase interacting protein 1 ( MGI:1917016)
Sequence:sense strand is shown

>T2494
CTGAACTGGCCCTAGCAAAGTACAATTTAAATATATTGCTTCCAGACAGATAATTCTTAGTTGTGCTGTC
TATGTGGTCTTAAATTCTTCCTGCTTCTGCAATCAGCATCCGCTCTTACAACTGTGTAGTGCTTTTGGGG
CTCCTAATCCACCCCACTCCACGATGCCTTCTGACACAGTGACTCTGTACTCACACTGGTGGAAAAGGAA
GAAAAGCCCTGGGCATGCAGTTGTGCAGGTCTCACGCGGAGCTGCTGCTAAGCAAAACCTCTCTGCCACT
CTCGGCTTGGCTGAGTTCCTCTCTTGGCTCAGGGTTAGTGATCTGGTAAGGTCTAGGAGGCTTAGGACCC
AGGGGGCGCCTTTCAGCTGAAAAACACCTCGGCTGCAGCAAGCTAGCTGGGAAGCTCCCAGTTCTAAAGA
GAGGCTGTTTACCAGAAGAGCATAACAGGGGCCGGCCAGTCTGACTGCAAGGAGACAAAACTGCTGCCAA
GGAGGACCCCCCCCCCCCATTTGGACACTGGCTGTTGAGTCACCTGCGA
Notes:The probe template was PCR amplified from IMAGE:1264323 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1264323 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19767 same embryo
 EMAGE:19769 same embryo
 EMAGE:19766 same embryo
 EMAGE:19768 same embryo
 EMAGE:19770 same embryo
 EurExpress:euxassay_006239 same experiment
 MGI:4827208 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS