Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19920

Nwd1 NACHT and WD repeat domain containing 1 ( MGI:2442268)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920
"Pseudo-wholemount" of euxassay_012570. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012570_01 euxassay_012570_02 euxassay_012570_03 euxassay_012570_04
EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920
euxassay_012570_05 euxassay_012570_06 euxassay_012570_07 euxassay_012570_08 euxassay_012570_09
EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920
euxassay_012570_10 euxassay_012570_11 euxassay_012570_12 euxassay_012570_13 euxassay_012570_14
EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920
euxassay_012570_15 euxassay_012570_16 euxassay_012570_17 euxassay_012570_18 euxassay_012570_19
EMAGE:19920 EMAGE:19920 EMAGE:19920 EMAGE:19920
euxassay_012570_20 euxassay_012570_21 euxassay_012570_22 euxassay_012570_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19920Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19920_wholemount_strong.wlz
19920_wholemount_moderate.wlz
19920_wholemount_weak.wlz
19920_wholemount_possible.wlz
19920_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19920_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon floor plate
moderate moderate
regionalmoderate expression: see section 13
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 13 14
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 15 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12 13
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 14 15 16
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 11 14
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
pons mantle layer
strong strong
regionalstrong expression: see section 06
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 11 14 16 17 18 19
midbrain floor plate
moderate moderate
regionalmoderate expression: see section 13
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35806
Entity Detected:Nwd1, NACHT and WD repeat domain containing 1 ( MGI:2442268)
Sequence:sense strand is shown

>T35806
CCACTCTTACTGGGTGTCACAAAGGCATCACCGCCATAGCATGGAGCCTGGAGGAGAAACTCCTGGTGGT
GGGCACCCAGGATGGTGCCATGGTCGTGTGGGACGTGGAGGAACAACAGGTGGTACACGTTCTAATGGGA
CACACAGCTGAAGTGAAGTGTGTGCGAGTGTTTGCCCAAGGGACTCTTGCCATCTCTGCATCAAAGGACC
ATACCCTGCGTCTGTGGAGTCTGCTTTCCGGCCAGGAGAAAGTCACCATTTTGGATGGAGGGTCACAAAA
TCCCACAGAGCCCCAGAGTTGGGACCTTCATGTGGATGAGAGAAACAATGTTGTATACTCGACATCTGGT
GCAAGGATCAACATGTGGAATCTGGAAACTTCGAAGCTGGTTTTCTGTATCACAGGAGATGTGTCTGATC
CCTGGGTCTGTGTGGCTTTGTTGGCTGCCCAGGGTTTGCTGCTTGCCCTGTCCAAGGGTGGCCAGGTCAG
TCTGTGGAGCTCAGCCATGGGAAAACTGCAGGAGAAACACCAGTTATCCAGCATCAAAGAAGAGACACCC
ACCTGTGCCGTCTCCATCCAGTCCCGGGCAAGGCTGGTCGCTGGCTTCAGCAGTGGCTCCATTGCCCTGG
TCTCCGCTGGAGAAGACAGGCTGCTGGAGAAGCTCCCAGAAGCTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 69082. Forward Primer - name:069082_F_cDNA_A230063L24Rik, sequence:CCACTCTTACTGGGTGTCACAA; Reverse Primer - name:069082_N_SP6_cDNA_A230063L24Rik, sequence:CACAGCTTCTGGGAGCTTCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19922 same embryo
 EMAGE:19923 same embryo
 EMAGE:19921 same embryo
 EurExpress:euxassay_012570 same experiment
 MGI:4826838 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS