Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20175

Noc4l nucleolar complex associated 4 homolog (S. cerevisiae) ( MGI:2140843)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175
"Pseudo-wholemount" of euxassay_012495. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012495_01 euxassay_012495_02 euxassay_012495_03 euxassay_012495_04
EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175
euxassay_012495_05 euxassay_012495_06 euxassay_012495_07 euxassay_012495_08 euxassay_012495_09
EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175
euxassay_012495_10 euxassay_012495_11 euxassay_012495_12 euxassay_012495_13 euxassay_012495_14
EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175
euxassay_012495_15 euxassay_012495_16 euxassay_012495_17 euxassay_012495_18 euxassay_012495_19
EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175 EMAGE:20175
euxassay_012495_20 euxassay_012495_21 euxassay_012495_22 euxassay_012495_23 euxassay_012495_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20175Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20175_wholemount_strong.wlz
20175_wholemount_moderate.wlz
20175_wholemount_weak.wlz
20175_wholemount_possible.wlz
20175_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20175_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 weak expression: see section 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 19 20 weak expression: see section 07 17 18
vibrissa
weak weak
regionalweak expression: see section 05 06 19 20 21
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
facial vii ganglion
weak weak
regionalweak expression: see section 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 04 05 06 07 08 17 18 19 20 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 13 16 17
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 12 14 15 16
lower jaw molar
weak weak
regionalweak expression: see section 07 08 19
upper jaw incisor
weak weak
regionalweak expression: see section 10 11 14 15
upper jaw molar
weak weak
regionalweak expression: see section 07 19
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
weak weak
regionalweak expression: see section 06 07 08 09 10 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31361
Entity Detected:Noc4l, nucleolar complex associated 4 homolog (S. cerevisiae) ( MGI:2140843)
Sequence:sense strand is shown

>T31361
CATGACTCCATCCTGCCCCACCTGGCCCAACCCACACTCATGATTGACTTCCTCACAAGTGCCTGTGATG
TGGGTGGTGCCATCAGCCTCCTGGCCTTGAACGGGCTTTTCATCCTAATCCATAAACACAACCTGGAGTA
CCCTGACTTCTACCAGAAGCTCTATGGTCTCCTGGATCCATCCATCTTTCATGTCAAGTACCGAGCCCGT
TTCTTCCACTTGGCTGACCTCTTCCTTTCATCCTCCCACCTCCCTGCCTACCTGGTGGCTGCCTTTGCCA
AACGCCTGGCTCGGCTGGCGCTAACAGCACCTCCTGAGGCCCTACTTATGGTCCTGCCTTTAATCTGCAA
CTTGCTGCGTAGACACCCTGCCTGCCGAGTTATGGTGCACCACCCACAGGGCCCTGAGCTAGATGCTGAT
CCATATGACCCAACGGAGAAGGACCCAGCCAGAAGCCGTGCCCTGGAGAGCTGCTTGTGGGAACTGCAGA
CCCTCCAGCAGCACTACCACCCTGAGGTGTCGAAAGCCGCCAGTGTCATCAACCAGGTGCTATCTGTCCC
TGAGGTCAGCATCGCGCCACTCCTGGAACTTACTGCATATGAGATCTTTGAGCAGGACCTGAAGAAGAAG
ATGCCTGAGTCAGTGCCCCTGGAGTTCATCCCCGCTAAAGGCCTATTGGGTCGACAGGACGACCTCTGTA
CCCAGTTCTTCTGTCTCAGCTGACCGGGCTGTCACTTCTCCTCCTAAGAATTGTTTTTGTGTGTCTGAGA
CAGGATCTCACTATGTGAGGGTAGCCTGTATCTTGTGGTACTCCTGCCTAAGCCTCCCCAGTACTGTATG
GGTGTTTTGATTGCATGGATGTCTGTTTATCACATGTAGGCCAGGTGAGGGTGTCAGATCCCCTATAACG
AGAATTACAGACACTTGTGAGCCACCGTGTTGGTGGTGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4218310), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 22996. Forward Primer - name:022996_F_IRAV55-58_C11_AI326906, sequence:CATGACTCCATCCTGCCC; Reverse Primer - name:022996_R_SP6_IRAV55-58_C11_AI326906, sequence:TTCACACCACCAACACGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20178 same embryo
 EMAGE:20179 same embryo
 EMAGE:20177 same embryo
 EMAGE:20174 same embryo
 EMAGE:20176 same embryo
 EurExpress:euxassay_012495 same experiment
 MGI:4826741 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS