Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20187

2010107G23Rik RIKEN cDNA 2010107G23 gene ( MGI:1917144)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187
"Pseudo-wholemount" of euxassay_012442. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012442_01 euxassay_012442_02 euxassay_012442_03 euxassay_012442_04
EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187
euxassay_012442_05 euxassay_012442_06 euxassay_012442_07 euxassay_012442_08 euxassay_012442_09
EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187
euxassay_012442_10 euxassay_012442_11 euxassay_012442_12 euxassay_012442_13 euxassay_012442_14
EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187
euxassay_012442_15 euxassay_012442_16 euxassay_012442_17 euxassay_012442_18 euxassay_012442_19
EMAGE:20187 EMAGE:20187 EMAGE:20187 EMAGE:20187
euxassay_012442_20 euxassay_012442_21 euxassay_012442_22 euxassay_012442_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20187Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20187_wholemount_strong.wlz
20187_wholemount_moderate.wlz
20187_wholemount_weak.wlz
20187_wholemount_possible.wlz
20187_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20187_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 08 17 18
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 09 10 11 12 15 16 17 18
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 07 12 14 15 16 18 19 20 21 22 23
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 10 11 12 15 16
midbrain mantle layer
weak weak
regionalweak expression: see section 09 10 11 13 15 16 17 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 17 18 19 20 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 16 18
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 12 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31324
Entity Detected:2010107G23Rik, RIKEN cDNA 2010107G23 gene ( MGI:1917144)
Sequence:sense strand is shown

>T31324
TTAGGGGCTGCAAAGCTGGGGTCCCCCAGAGCCGCAGCTGCAGCTCACACACCTTGTGGTGGGAGGTTGG
ACTTCGTCCTTTACCTGGGTGTTCCCTGCAGGGTTTCACTTAGCAGAAGCTGGCCTTTAACCCCTGACCT
TCCAGCCTGTACCTCCTTGGAGTTCTGGTGTTGATTACAGGTACTGCACAGCAGAAATTCCCAGCGTCCA
GGGAGAATGGTGAGGATCTTGGCCAATGGGGAGATCGTTCAGGATGATGACCCACGAGTGAGGACGACCA
CCCAGCACAGAAGTAGTAGCTCTCAGCAGGGCTTTTTCAACAGAGGCCACGGCGCACCTCCAGGGGGCCC
TGGACCCCGCCAGCAGCAGGCAGGTGCCCGACTGGGTGCTGCCCAATCTCCTTTCAGTGACCTGAACCGG
CAGCTGGTGAACATGGGCTTCCCACAATGGCACCTTGGGAACCACGTGGTGGAACCTGTGACCTCCATCC
TCCTGCTCTTCCTGCTTATGATGCTCGGGGTTCGTGGCCTCCTGCTTGTGGGCCTGGTCTACCTGGTGTC
TCACCTGAGTCAGCGGTGACCTCCGGGGGACTCATGAGGGCGGGAGTGTTCAGTAGGATCGACTGGACTG
GGCTTTGGTGCGACATCATGCACAGGGGGAGGGAGCTTGGGTGGGCTCAGAAGGTGTGATGGGCATGAGA
CCGGCTTTGTAGATTTTTCTCCCGCTGCAGGAGGCAGAGGGACTCTCTGGGCCAGCATTGCTGAAAAAGA
GAGTCCTGTGGTTTCCTGGAATGTTTTTAGGGGGCATAGGGCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3989515), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 22036. Forward Primer - name:022036_F_IRAV51-54_H18_2010107G23Rik, sequence:TTAGGGGCTGCAAAGCTG; Reverse Primer - name:022036_R_SP6_IRAV51-54_H18_2010107G23Rik, sequence:GAAGCCCTATGCCCCCTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20188 same embryo
 EMAGE:20190 same embryo
 EMAGE:20186 same embryo
 EMAGE:20189 same embryo
 EurExpress:euxassay_012442 same experiment
 MGI:4822646 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS