Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20252

Ccdc28b coiled coil domain containing 28B ( MGI:1913514)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252
"Pseudo-wholemount" of euxassay_012331. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012331_01 euxassay_012331_02 euxassay_012331_03 euxassay_012331_04
EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252
euxassay_012331_05 euxassay_012331_06 euxassay_012331_07 euxassay_012331_08 euxassay_012331_09
EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252
euxassay_012331_10 euxassay_012331_11 euxassay_012331_12 euxassay_012331_13 euxassay_012331_14
EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252
euxassay_012331_15 euxassay_012331_16 euxassay_012331_17 euxassay_012331_18 euxassay_012331_19
EMAGE:20252 EMAGE:20252 EMAGE:20252 EMAGE:20252
euxassay_012331_20 euxassay_012331_21 euxassay_012331_22 euxassay_012331_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20252Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20252_wholemount_strong.wlz
20252_wholemount_moderate.wlz
20252_wholemount_weak.wlz
20252_wholemount_possible.wlz
20252_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20252_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 17 weak expression: see section 14 15 16
thyroid gland
moderate moderate
regionalmoderate expression: see section 17
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
spinal cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16 17 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31251
Entity Detected:Ccdc28b, coiled coil domain containing 28B ( MGI:1913514)
Sequence:sense strand is shown

>T31251
CCAGACCCCAAACTTCCAGACCTGAGGTCCAACACACCACCCAATGGAAGACAAAAAGAAGAAACGGAGT
CCTAAGCCCTGCCTGACCCAACAAGCACAGGCCCCAGGCACACTGCGCAGAGTCCCTGTGCCCACCAGCC
ACAGTGGCTCCTTGGCTCTGGGACTCCCTCATTTGCCATCACCTAAGCAGCGAGCCAAGTTCAAGAGAGC
AGGCAAGGAGAAATGCCGACCGGTGCTGGCTGGAGGTGGAGGCGGCTCCGCAGGCACACCCCTGCAACAC
TCCTTCCTGACAGAGGTGACAGATGTTTATGAGATGGAGGGAGGACTGCTGAACTTGCTCAATGATTTTC
ATTCAGGCCGCCTGCAGGCCTTTGGGAAGGAATGTTCCTTCGAGCAGCTGGAGCATGTTCGGGAGATGCA
GGAGAAGTTGGCCAGACTGCACTTCAGCCTGGATGTGTGTGGGGAGGAAGAGGACGAGGAAGAAGAGGAG
GATGGGGTCACAGAAGGCTTGCCTGAGGAGCAGAAGAAGACAATGGCTGACCGCAACCTGGACCAGCTGC
TTAGCAATCTGGAAGATCTTAGCAATTCCATACAGAAGCTACACTTGGCAGAGAATGCTGAGCCTGAGGA
CCAGCCAGCTGCGTAGGTGTCGCCTAAACTCTTCTGCTACTCTCCTCTTCAAACTGTGAATTTTACGGAT
TCGGAAGCCCCTTGGTGCTATGGGGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4220355), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55725. Forward Primer - name:055725_F_IRAV49_d01_1810010N17Rik, sequence:CCAGACCCCAAACTTCCA; Reverse Primer - name:055725_R_SP6_IRAV49_d01_1810010N17Rik, sequence:CGACCCCATAGCACCAAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20255 same embryo
 EMAGE:20254 same embryo
 EMAGE:20253 same embryo
 EurExpress:euxassay_012331 same experiment
 MGI:4823672 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS