Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20253

Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 ( MGI:2151075)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253
"Pseudo-wholemount" of euxassay_012361. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012361_01 euxassay_012361_02 euxassay_012361_03 euxassay_012361_04
EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253
euxassay_012361_05 euxassay_012361_06 euxassay_012361_07 euxassay_012361_08 euxassay_012361_09
EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253
euxassay_012361_10 euxassay_012361_11 euxassay_012361_12 euxassay_012361_13 euxassay_012361_14
EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253 EMAGE:20253
euxassay_012361_15 euxassay_012361_16 euxassay_012361_17 euxassay_012361_18 euxassay_012361_19
EMAGE:20253 EMAGE:20253 EMAGE:20253
euxassay_012361_20 euxassay_012361_21 euxassay_012361_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20253Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20253_wholemount_strong.wlz
20253_wholemount_moderate.wlz
20253_wholemount_weak.wlz
20253_wholemount_possible.wlz
20253_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20253_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
spinal cord meninges
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 18 weak expression: see section 10 11 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
utricle
moderate moderate
regionalmoderate expression: see section 05 20 21
anterior naris
strong strong
regionalstrong expression: see section 14 15
posterior naris
strong strong
regionalstrong expression: see section 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 06 07
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10
lower lip
strong strong
regionalstrong expression: see section 08 11 12 13 14 15 16 17 18 19
upper lip
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
kidney calyx
moderate moderate
regionalmoderate expression: see section 05 12 14
kidney pelvis
moderate moderate
regionalmoderate expression: see section 13
ureter
moderate moderate
regionalmoderate expression: see section 05 06 07
renal cortex
moderate moderate
regionalmoderate expression: see section 04 05 06 12 13 14 15
left lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
right lung
strong strong
regionalstrong expression: see section 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31252
Entity Detected:Tnfrsf21, tumor necrosis factor receptor superfamily, member 21 ( MGI:2151075)
Sequence:sense strand is shown

>T31252
TCTGCCCACCTGGAATGTATCAGTCTAATGGTACCTGCGCTCCCCATACAGTGTGCCCCGTGGGCTGGGG
TGTGCGGAAGAAAGGGACAGAGAATGAAGATGTGCGCTGTAAGCAGTGCGCTCGGGGTACCTTCTCTGAC
GTGCCTTCCAGTGTGATGAAGTGTAAAGCTCACACGGACTGTCTGGGTCAGAACCTGGAGGTGGTCAAGC
CAGGGACCAAGGAGACAGACAACGTCTGTGGCATGCGCCTGTTCTTCTCCAGCACAAACCCACCTTCCTC
TGGCACAGTTACCTTTTCTCACCCTGAGCATATGGAATCCCACGATGTCCCTTCCTCCACCTATGAGCCC
CAAGGCATGAACTCAACAGATTCCAACTCTACTGCCTCTGTTAGAACTAAGGTACCAAGTGGCATCGAGG
AAGGGACAGTGCCTGACAATACGAGCTCAACCAGTGGGAAGGAAGGCACTAATAGGACCCTGCCAAACCC
ACCACAAGTTACCCACCAGCAAGCCCCCCACCACAGACACATTCTGAAGCTGCTGCCATCGTCCATGGAG
GCCACGGGTGAGAAGTCCAGCACAGCCATCAAGGCCCCCAAGAGGGGTCACCCCAGACAGAACGCTCACA
AGCATTTCGACATCAACGAGCACTTGCCTTGGATGATCGTCCTCTTCCTTCTGCTGGTCCTGGTGCTGAT
AGTGGTGTGCAGTATCCGAAAGAGCTCCAGGACTCTCAAAAAGGGGCCCCGGCAGGATCCCAGCGCCATA
GTGGAAAAGGCGGGGCTGAAGAAGTCCCTGACTCCCACCCAGAACCGGGAGAAATGGATCTACTACCGCA
ACGGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4220624), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55730. Forward Primer - name:055730_F_IRAV49_d02_Tnfrsf21, sequence:TCTGCCCACCTGGAATGT; Reverse Primer - name:055730_R_SP6_IRAV49_d02_Tnfrsf21, sequence:ATGGCCGTTGCGGTAGTA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20255 same embryo
 EMAGE:20252 same embryo
 EMAGE:20254 same embryo
 EurExpress:euxassay_012361 same experiment
 MGI:4828846 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS