Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20506

Rnaset2a ribonuclease T2A ( MGI:1915445)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506
"Pseudo-wholemount" of euxassay_012749. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012749_01 euxassay_012749_02 euxassay_012749_03 euxassay_012749_04
EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506
euxassay_012749_05 euxassay_012749_06 euxassay_012749_07 euxassay_012749_08 euxassay_012749_09
EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506
euxassay_012749_10 euxassay_012749_11 euxassay_012749_12 euxassay_012749_13 euxassay_012749_14
EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506 EMAGE:20506
euxassay_012749_15 euxassay_012749_16 euxassay_012749_17 euxassay_012749_18 euxassay_012749_19
EMAGE:20506 EMAGE:20506
euxassay_012749_20 euxassay_012749_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20506Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20506_wholemount_strong.wlz
20506_wholemount_moderate.wlz
20506_wholemount_weak.wlz
20506_wholemount_possible.wlz
20506_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20506_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
regionalstrong expression: see section 07 08 16 moderate expression: see section 09 14 15
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 13
vibrissa
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 19
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 11
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain roof plate
weak weak
regionalweak expression: see section 10
mandible
weak weak
regionalweak expression: see section 04 05 06 07 08 10 15 16 17 18 19
metanephros
weak weak
regionalweak expression: see section 07 08 09 16 17
ovary
moderate moderate
regionalmoderate expression: see section 05 06 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38231
Entity Detected:Rnaset2a, ribonuclease T2A ( MGI:1915445)
Sequence:sense strand is shown

>T38231
AGGTTAACAGCTGCCAAGACTCTCTGGATTACTGGACAATACATGGACTATGGCCCGATAGAGCAGAAGA
TTGTAACCAGTCCTGGCACTTTAACTTAGATGAGATTAAGGACCTTTTGCGAGACATGAAGATCTACTGG
CCCGATGTGATTCACCGGTCTTCTAATCGCAGCCAATTCTGGAAACATGAGTGGGTTAAACACGGCACCT
GTGCTGCCCAGGTAGACGCCCTCAATTCCGAGAAGAAGTACTTTGGGAAGAGCCTGGATCTGTACAAGCA
GATTGACCTCAACAGTGTGCTACAAAAATTTGGGATCAAGCCATCCATCAACTACTACCAGCTTGCAGAT
TTCAAAGATGCACTTACCAGAATCTATGGTGTGGTGCCTAAAATCCAGTGCCTTATGCCAGAACAGGGAG
AGAGCGTGCAGACCGTTGGCCAGATAGAGCTGTGCTTCACCAAGGAGGACTTACATTTGCGGAACTGCAC
TGAGCCAGGGGAGCAGCTGTCCTCCAGGCAGGAAGCCTGGCTGGCCATGGAGGCTTCTACACATGGGATG
ATGGTCTGTGAAGACGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 141955. Forward Primer - name:141955_F_cDNA_Rnaset2, sequence:AGGTTAACAGCTGCCAAGACTC; Reverse Primer - name:141955_N_SP6_cDNA_Rnaset2, sequence:CCGTCTTCACAGACCATCATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20505 same assay
 EMAGE:20508 same embryo
 EMAGE:20507 same embryo
 EMAGE:20503 same embryo
 EMAGE:20504 same embryo
 EurExpress:euxassay_012749 same experiment
 EMAGE:20509 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS