EMAGE mouse gene expression spatial database

EMAGE:20749

Olfr211 olfactory receptor 211 ( MGI:3030045)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_013944. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_013944_01	euxassay_013944_02	euxassay_013944_03	euxassay_013944_04

euxassay_013944_05	euxassay_013944_06	euxassay_013944_07	euxassay_013944_08	euxassay_013944_09

euxassay_013944_10	euxassay_013944_11	euxassay_013944_12	euxassay_013944_13	euxassay_013944_14

euxassay_013944_15	euxassay_013944_16	euxassay_013944_17	euxassay_013944_18	euxassay_013944_19

euxassay_013944_20	euxassay_013944_21	euxassay_013944_22	euxassay_013944_23	euxassay_013944_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

strong

single cell

strong expression: see section 07 08 11 13 14 16 17

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T39210
Entity Detected:	Olfr211, olfactory receptor 211 ( MGI:3030045)
Sequence:	sense strand is shown >T39210 CATCCTTCAGGGCTTCTCTGAGCACCCACAGTACCAGCTGCCCTTGTTTTTCTGTTTCCTCTCCCTTTAC TGTGTGGCCCTCACAGGTAATGTCCTTATCATCTTGGCTATCACCTGCAACCCTGGGCTCCACACCCCCA TGTATTTTTTCTTGTTTAATTTGGCTACTATGGACATCATCTGTACCTCCTCCATTATGCCCAAGGCCCT GAGGGGTCTGGTGTCAAAGAGGAACCCCATCTCCTACGGTGGCTG
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 279049. Forward Primer - name:279049_F_cDNA_Olfr211, sequence:CATCCTTCAGGGCTTCTCTG; Reverse Primer - name:279049_N_SP6_cDNA_Olfr211, sequence:CAGCCACCGTAGGAGATG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:20747 same embryo
	EMAGE:20748 same embryo
	EMAGE:20746 same embryo
	EurExpress:euxassay_013944 same experiment
	MGI:4826906 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source