Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21279

Hrsp12 heat-responsive protein 12 ( MGI:1095401)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279
"Pseudo-wholemount" of euxassay_009123. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009123_01 euxassay_009123_02 euxassay_009123_03 euxassay_009123_04
EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279
euxassay_009123_05 euxassay_009123_06 euxassay_009123_07 euxassay_009123_08 euxassay_009123_09
EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279
euxassay_009123_10 euxassay_009123_11 euxassay_009123_12 euxassay_009123_13 euxassay_009123_14
EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279
euxassay_009123_15 euxassay_009123_16 euxassay_009123_17 euxassay_009123_18 euxassay_009123_19
EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279 EMAGE:21279
euxassay_009123_20 euxassay_009123_21 euxassay_009123_22 euxassay_009123_23 euxassay_009123_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21279Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21279_wholemount_strong.wlz
21279_wholemount_moderate.wlz
21279_wholemount_weak.wlz
21279_wholemount_possible.wlz
21279_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21279_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 3 4 5 moderate expression: see section 1 2
pancreas
strong strong
regionalstrong expression: see section 1 2 3 4 5 6
thyroid gland
strong strong
regionalstrong expression: see section 4 5 moderate expression: see section 1
rectum
strong strong
regionalstrong expression: see section 3 4
midgut
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8
liver
strong strong
regionalstrong expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
urinary system
strong strong
spottedstrong expression: see section 4 5 9
metanephros
strong strong
regionalstrong expression: see section 7 8 9 5 6 7
left lung
strong strong
regionalstrong expression: see section 4 5 6 7 8 9 0 1 2
right lung
strong strong
regionalstrong expression: see section 2 3 4 5 6 7 8 9 0 1 2
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1157
Entity Detected:Hrsp12, heat-responsive protein 12 ( MGI:1095401)
Sequence:sense strand is shown

>T1157
CTCGAGCCTGTTGGCCTACTGGAGTGGACAAGAGTGGGTGTAGTTACTTACCATCGTTTCTTCTTCTGGA
GGGTCTTCAAGAGGGAAGGATTAGCATGTCGTCCATAATCAGAAAGGTGATCAGCACCACAAAAGCCCCG
GCGGCCATTGGTCCCTACAGTCAAGCTGTGCAAGTGGACAGGACCATTTACATTTCTGGACAGGTAGGCC
TGGATCCTTCCAGTGGACAGCTTGTGCCAGGAGGAGTAGTAGAAGAAGCTAAACAGGCTCTTAAAAACTT
GGGTGAGATTCTGAAAGCTGCAGGCTGTGACTTCAATAATGTGGTGAAAACAACTGTTTTACTGGCTGAC
ATGAATGACTTTGGCACTGTCAATGAGATCTATAAAACATATTTCCAGGGTAGCCTTCCTGCCAGGGCTG
CTTACCAAGTCGCTGCTTTACCCAGAGGAAGTCGAGTTGAAATCGAAGCAATCGCTGTCCAGGGGCCTTT
CATCAAGGCATGACTATAAGTAGCCATGCTGATGTTGACTCCGGAGGTTTTAGAATGTCTTTCACACTTT
AATTTTTACAAATGATGCTGGGAAGTAT
Notes:The probe template was PCR amplified from IMAGE:2136704 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2136704 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009123 same experiment
 EMAGE:21275 same embryo
 EMAGE:21276 same embryo
 EMAGE:21277 same embryo
 EMAGE:21278 same embryo
 EMAGE:21280 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS