Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21345

Zfp750 zinc finger protein 750 ( MGI:2442210)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345
"Pseudo-wholemount" of euxassay_000001. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000001_01 euxassay_000001_02 euxassay_000001_03 euxassay_000001_04
EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345
euxassay_000001_05 euxassay_000001_06 euxassay_000001_07 euxassay_000001_08 euxassay_000001_09
EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345
euxassay_000001_10 euxassay_000001_11 euxassay_000001_12 euxassay_000001_13 euxassay_000001_14
EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345
euxassay_000001_15 euxassay_000001_16 euxassay_000001_17 euxassay_000001_18 euxassay_000001_19
EMAGE:21345 EMAGE:21345 EMAGE:21345 EMAGE:21345
euxassay_000001_20 euxassay_000001_21 euxassay_000001_22 euxassay_000001_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21345Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21345_wholemount_strong.wlz
21345_wholemount_moderate.wlz
21345_wholemount_weak.wlz
21345_wholemount_possible.wlz
21345_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21345_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
peritoneal component
strong strong
single cellstrong expression: see section 3
organ system
moderate moderate
regionalmoderate expression: see section 3
thymus primordium
strong strong
single cellstrong expression: see section 3 4 5 6 7 9
oral region gland
strong strong
regionalstrong expression: see section 9
salivary gland
strong strong
single cellstrong expression: see section 8 moderate expression: see section 0
sublingual gland primordium
strong strong
regionalstrong expression: see section 8 9 moderate expression: see section 9 0 1 2 0
submandibular gland primordium
strong strong
homogeneousstrong expression: see section 8 moderate expression: see section 9 0 1 2 1
thyroid gland
strong strong
homogeneousstrong expression: see section 9 0
thyroid gland lobe
strong strong
homogeneousstrong expression: see section 9 0
epidermis
strong strong
homogeneousstrong expression: see section 1 3 4 6 7 8 9 0 1
vibrissa
strong strong
regionalstrong expression: see section 2
vibrissa dermal component
moderate moderate
regionalmoderate expression: see section 9 0
vibrissa epidermal component
strong strong
homogeneousstrong expression: see section 2 3 4 6
cerebral cortex
strong strong
regionalstrong expression: see section 7 moderate expression: see section 3 4 5
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 9
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 9 0
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 8 9 1 3 moderate expression: see section 4 5 6 7 8 9 0 0
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 9 0
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 9 moderate expression: see section 8 8 0 1
cervical ganglion
moderate moderate
homogeneousmoderate expression: see section 1
superior cervical ganglion
moderate moderate
homogeneousmoderate expression: see section 1
peripheral nerve trunk
moderate moderate
homogeneousmoderate expression: see section 2
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 1 2
outer ear
strong strong
homogeneousstrong expression: see section 3
external auditory meatus
strong strong
homogeneousstrong expression: see section 3 4
conjunctival sac
weak weak
regionalweak expression: see section 7
not examined not examined
othernot examined expression: see section 2
not examined not examined
homogeneousnot examined expression: see section 1 2 3 2 3
retina
weak weak
regionalweak expression: see section 1 2 3 3
nasal cavity
strong strong
homogeneousstrong expression: see section 3
nasal cavity respiratory epithelium
strong strong
homogeneousstrong expression: see section 7 8 3 moderate expression: see section 9 0 1 2 4
nasal septum
strong strong
regionalstrong expression: see section 2
tongue mesenchyme
moderate moderate
regionalmoderate expression: see section 7 weak expression: see section 4
rest of hindgut epithelium
strong strong
regionalstrong expression: see section 3 4 5 6 7 8
oral epithelium
strong strong
homogeneousstrong expression: see section 6 7 2
palatal shelf epithelium
strong strong
homogeneousstrong expression: see section 6 7 5
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1773
Entity Detected:Zfp750, zinc finger protein 750 ( MGI:2442210)
Sequence:sense strand is shown

>T1773
TGGCCTCGAGGCAGATTCGGACGAGGGGGAAGTCCAGTTCCTGAGGCTAAAGATCCTTCTAAAGATGGGC
AAAGGGATGCAGAAGAAGCCAAAATGAGCCCCCGAGCAGGGAGCGCTGCCACGGGCTCCCCGGGGAGGCC
AAGCCCCACCAACTTCACCCAAACAAGCCAAACATTCGAAGGCCTGTGTGACCTCTCAAACAAAGCAGCC
TCCTCCGGAACCCTAGAGCGACTCCAGCAAGCTGAGCAGAGCCCCACCGCCTTCAAACCTGTCCAAAGGG
GTTCAGAAAGCCCTCACTCTCAACCTCCTGCAAACAGAACAGAGTCTCCAAAAAGCCTTCAGGCCATGAA
TGGTGACCCTCCGGCCCAGACAGGGGAGCAGTAACTCTTTCATCACAGAGGCCCCACCCTCCAGCCCAGA
GGACCACTCCAGAATAGGTCCCCTTCAATCTCTCTAAGAAGCTGGGAGACAAACCCTGCAGCCACGTATG
GGACCCATGTATGCAAGC
Notes:The probe template was PCR amplified from IMAGE:492529 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:492529 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000001 same experiment
 EMAGE:21344 same embryo
 EMAGE:21343 same embryo
 EMAGE:21346 same embryo
 EMAGE:21342 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS