Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21459

Cds1 CDP-diacylglycerol synthase 1 ( MGI:1921846)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459
euxassay_000934_01 euxassay_000934_02 euxassay_000934_03 euxassay_000934_04 euxassay_000934_05
EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459
euxassay_000934_06 euxassay_000934_07 euxassay_000934_08 euxassay_000934_09 euxassay_000934_10
EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459
euxassay_000934_11 euxassay_000934_12 euxassay_000934_13 euxassay_000934_14 euxassay_000934_15
EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459 EMAGE:21459
euxassay_000934_16 euxassay_000934_17 euxassay_000934_18 euxassay_000934_19 euxassay_000934_20
EMAGE:21459 EMAGE:21459 EMAGE:21459
euxassay_000934_21 euxassay_000934_22 euxassay_000934_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21459Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21459_wholemount_strong.wlz
21459_wholemount_moderate.wlz
21459_wholemount_weak.wlz
21459_wholemount_possible.wlz
21459_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21459_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
homogeneousweak expression: see section 8
thymus primordium
strong strong
homogeneousstrong expression: see section 2 3 4 5 6
vibrissa
weak weak
regionalweak expression: see section 5 6 7 1 2 3
thalamus mantle layer
strong strong
regionalstrong expression: see section 8 9 0 7 8 moderate expression: see section 6 weak expression: see section 1 5 9
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 3 4 7 8 9 0 weak expression: see section 6 7 8 9 0
4th ventricle
moderate moderate
homogeneousmoderate expression: see section 0 1 2 3 4 7 8 9 0 1 2 weak expression: see section 4 5 7 8 9 5 6 not examined expression: see section 6
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 3 4
medulla oblongata basal plate
moderate moderate
homogeneousmoderate expression: see section 9 0 7 weak expression: see section 8 8
medulla oblongata basal plate ventricular layer
moderate moderate
homogeneousmoderate expression: see section 3
pons ventricular layer
moderate moderate
homogeneousmoderate expression: see section 3
ventral grey horn
moderate moderate
regionalmoderate expression: see section 2 3 4 7
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 9 0 1 2 3 5 6 7 8 9 moderate expression: see section 8
hindgut
moderate moderate
regionalmoderate expression: see section 3 not examined expression: see section 4 5
bladder
moderate moderate
regionalmoderate expression: see section 4 5
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 9 1 weak expression: see section 8 2 8 2
kidney pelvis
moderate moderate
homogeneousmoderate expression: see section 0 1 0 weak expression: see section 9
laryngeal cartilage
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T365
Entity Detected:Cds1, CDP-diacylglycerol synthase 1 ( MGI:1921846)
Sequence:sense strand is shown

>T365
TATCTACAGAACCCTGAAGATTCATCTCACCGAGAAAGGGATCCTGCAGCCCACCTTGAAGGTGTAGCTG
CCCTTGAGGACGACGGGCTGCTGAGGAGGAGCTCACAGACCAGCTCTGACTGGAGCCGTGCACTGAGCCA
GCCTGGGGCTAAAACTCAGTAGATGCAGGCTTTGCAGATACAAAGGTTTCTTTTTCTGAATTTACAATTA
CTGTGAATATTTAACAAACACGTGGTCTAAGGTGAGTGCAGCAGTCGCCCACCCGTGAAAGATCCTGTAC
TTTTCTAAAATGTATTTTCCAATGTTAAGTTCTCTGCCCTCACTGGCCAGGTTCCATGATTTAGGTAGAC
TTGCGTTTTAAAGAGTCAAACACTATCAACTGAGGCCCTCGTAGGGTGTTGACCTTTGCCCTGGTGCTGC
CCTGGCGTAGCCATAGCTGAATGCACTGGAGGCACCTTGGGAATCGAGGTCTC
Notes:The probe template was PCR amplified from IMAGE:3155865 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3155865 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000934 same experiment
 EMAGE:21460 same embryo
 EMAGE:21464 same embryo
 EMAGE:21463 same embryo
 EMAGE:21461 same embryo
 EMAGE:21462 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS