Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21502

Ndufa1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 ( MGI:1929511)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502
euxassay_003059_01 euxassay_003059_02 euxassay_003059_03 euxassay_003059_04 euxassay_003059_05
EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502
euxassay_003059_06 euxassay_003059_07 euxassay_003059_08 euxassay_003059_09 euxassay_003059_10
EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502
euxassay_003059_11 euxassay_003059_12 euxassay_003059_13 euxassay_003059_14 euxassay_003059_15
EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502
euxassay_003059_16 euxassay_003059_17 euxassay_003059_18 euxassay_003059_19 euxassay_003059_20
EMAGE:21502 EMAGE:21502 EMAGE:21502 EMAGE:21502
euxassay_003059_21 euxassay_003059_22 euxassay_003059_23 euxassay_003059_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21502Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21502_wholemount_strong.wlz
21502_wholemount_moderate.wlz
21502_wholemount_weak.wlz
21502_wholemount_possible.wlz
21502_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21502_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 3 4 5 6 0 1 2
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 7 8
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 8 7 8 9 0 1 2
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 8
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4705
Entity Detected:Ndufa1, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 ( MGI:1929511)
Sequence:sense strand is shown

>T4705
AGCCGGGTCACCTCTGAGGAGCCGGTGACGGGTTGGCGTGCGAGTAACGGTGCGGAGATGTGGTTCGAGA
TTCTCCCTGGCCTCGCCATTATGGGGGTGTGCTTGGTCATCCCCGGGGTGTCCACTGCGTACATCCACAA
ATTCACCAACGGGGGCAAGGAAAAACGAGTTGCTCGTGTTCAGTACCAGTGGTATCTGATGGAACGCGAT
AGACGTATCTCTGGAGTCAATCGCTACTATGTGTCCAAGGGCCTGGAAAACATTGACTAAGGAAGCATTT
TCCTGGCTGATTAAAAGAAATTACTCAGCTATGGTCATCTGTTCCTGTTAGAAGGCTATGCAGCATATTA
TATACTATGCGCATGTTATGAAATGCATAATAAAAAATTTTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5031206 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5031206 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_003059 same experiment
 EMAGE:21504 same embryo
 EMAGE:21501 same embryo
 EMAGE:21503 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS