Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31154

Ciao1 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) ( MGI:1346998)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154
euxassay_002467_01 euxassay_002467_02 euxassay_002467_03 euxassay_002467_04 euxassay_002467_05
EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154
euxassay_002467_06 euxassay_002467_07 euxassay_002467_08 euxassay_002467_09 euxassay_002467_10
EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154
euxassay_002467_11 euxassay_002467_12 euxassay_002467_13 euxassay_002467_14 euxassay_002467_15
EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154
euxassay_002467_16 euxassay_002467_17 euxassay_002467_18 euxassay_002467_19 euxassay_002467_20
EMAGE:31154 EMAGE:31154 EMAGE:31154 EMAGE:31154
euxassay_002467_21 euxassay_002467_22 euxassay_002467_23 euxassay_002467_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 22 23
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3020
Entity Detected:Ciao1, cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) ( MGI:1346998)
Sequence:sense strand is shown

>T3020
TGGCCTCGAGCCAGATTCGGACGAGGCCCATTCCCAGGATGTCAACTGTGTGGCTTGGAATCCCAAGGAG
CCAGGGCTCCTGGCCTCTTGTAGTGATGATGGGGAGGTAGCCTTCTGGGAGTATCACCAGCCTGCAGGTC
TCTGAGCTATAGCTTGACTTGGGAGTCTTGATTCCCACAGAAAACGTCCTAAGACTTCTAGTCGTCAAGA
AGACCTGAAGCATCCTTGACCTTCATTTTGCTCAGGACTATTCACTGTTTCCCTTCCTTGATTATGAGGA
AGCCATTGGAGAGAGCCACAGAAAAGCAGTATATTGTATTAAAGTTTTGCTTGATTTAGGGCATGGTGTT
ACATTTTGGGGGTAAAATATATTTATAATCAATATAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1533558 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1533558 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002467 same experiment
 EMAGE:31274 same embryo
 EMAGE:31267 same embryo
 EMAGE:29448 same embryo
 EMAGE:30301 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS