Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31163

Scg2 secretogranin II ( MGI:103033)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163
euxassay_010094_01 euxassay_010094_02 euxassay_010094_03 euxassay_010094_04 euxassay_010094_05
EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163
euxassay_010094_06 euxassay_010094_07 euxassay_010094_08 euxassay_010094_09 euxassay_010094_10
EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163
euxassay_010094_11 euxassay_010094_12 euxassay_010094_13 euxassay_010094_14 euxassay_010094_15
EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163
euxassay_010094_16 euxassay_010094_17 euxassay_010094_18 euxassay_010094_19 euxassay_010094_20
EMAGE:31163 EMAGE:31163 EMAGE:31163 EMAGE:31163
euxassay_010094_21 euxassay_010094_22 euxassay_010094_23 euxassay_010094_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
strong strong
spottedstrong expression: see section 09 10 11 12 13 14 15 16
pituitary gland
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
olfactory cortex marginal layer
strong strong
spottedstrong expression: see section 09 10 11 12 14 15 16 17
pons mantle layer
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
dorsal grey horn
strong strong
spottedstrong expression: see section 11
hypothalamus mantle layer
strong strong
spottedstrong expression: see section 09 10 11 12 13 14 15 16 17
pancreas
strong strong
single cellstrong expression: see section 09 10
medulla oblongata basal plate mantle layer
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
adrenal gland
strong strong
regionalstrong expression: see section 07 08 09 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 07 08 09 10 15 16 weak expression: see section 11 14
telencephalon mantle layer
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 07 08 09 10 16 17 18
diencephalon lateral wall mantle layer
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32096
Entity Detected:Scg2, secretogranin II ( MGI:103033)
Sequence:sense strand is shown

>T32096
TGGAGCTAAGGCGTACCGACTTGGAGCAGTTCTGCTTCTTATCCACTTAATTTTCCTCATCTCTGGAGCC
GAAGCAGCTTCCTTCCAGCGAAACCAGCTGCTTCAGAAAGAACCAGACCTCAGATTGGAGAATGTCCAAA
AGTTTCCTAGTCCAGAAATGATCAGGGCTTTGGAGTACATAGAAAAGCTCAGGCAGCAAGCTCACAGAGA
AGAAAGCAGCCCAGACTACAATCCCTACCAAGGCGTCTCTGTTCCTCTTCAACTCAAAGAAAACGGAGAA
GAAAGCCACTTGGCAGAGAGCTCAAGGGATGCACTGAGTGAAGACGAGTGGATGCGGATAATACTCGAGG
CTCTGAGGCAGGCTGAAAATGAGCCGCCATCTGCCCCCAAAGAGAACAAGCCCTATGCCTTGAATCTGGA
GAAGAACTTCCCAGTGGACACGCCTGATGACTATGAGACTCAACAGTGGCCTGAGAGGAAACTCAAGCAC
ATGCGGTTCCCTCTCATGTATGAAGAGAATTCCAGAGAAAACCCCTTCAAACGCACAAATGAAATAGTCG
AGGAACAATACACACCCCAAAGTCTTGCTACCCTGGAGTCTGTGTTCCAAGAGCTTGGGAAACTGACAGG
GCCAAGCAACCAGAAGCGTGAGAGGGTTGACGAGGAACAAAAGCTGTACACAGATGATGAAGACGACGTG
TACAAGACCAACAACATTGCCTATGAAGATGTCGTGGGGGGAGAAGACTGGAGCCCCATAGAGGAGAAAA
TAGAGACTCAAACCCAGGAAGAGGTGAGAGACAGCAAAGAGAACACAGAAAAAAATGAACAAATCAATGA
AGAGATGAAACGTTCAGGGCAGTTGGGGCTCCCAGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6493827), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58185. Forward Primer - name:058185_F_IRAV91_b04_Scg2, sequence:TGGAGCTAAGGCGTACCG; Reverse Primer - name:058185_R_SP6_IRAV91_b04_Scg2, sequence:ATCTGGGAGCCCCAACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_010094 same experiment
 EMAGE:29392 same embryo
 EMAGE:29370 same embryo
 EMAGE:31177 same embryo
 EMAGE:31056 same embryo
 EMAGE:29402 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS