Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31223

Rasgef1b RasGEF domain family, member 1B ( MGI:2443755)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223
euxassay_000486_01 euxassay_000486_02 euxassay_000486_03 euxassay_000486_04 euxassay_000486_05
EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223
euxassay_000486_06 euxassay_000486_07 euxassay_000486_08 euxassay_000486_09 euxassay_000486_10
EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223
euxassay_000486_11 euxassay_000486_12 euxassay_000486_13 euxassay_000486_14 euxassay_000486_15
EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223
euxassay_000486_16 euxassay_000486_17 euxassay_000486_18 euxassay_000486_19 euxassay_000486_20
EMAGE:31223 EMAGE:31223 EMAGE:31223 EMAGE:31223
euxassay_000486_21 euxassay_000486_22 euxassay_000486_23 euxassay_000486_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
not examined not examined
homogeneousnot examined expression: see section 01 02 03 04 05 06 07 08 09 10
medulla oblongata basal plate
weak weak
homogeneousweak expression: see section 11 14
cerebral cortex mantle layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 03 04 05 18 19 20 21 22
not examined not examined
homogeneousnot examined expression: see section 04 05 06
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 11 12 13 14 15 18 19
olfactory cortex marginal layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 14 15 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08 09 18 19 20 21 22 weak expression: see section 06 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T159
Entity Detected:Rasgef1b, RasGEF domain family, member 1B ( MGI:2443755)
Sequence:sense strand is shown

>T159
TTTCCCACAGCTGACAGATGGACTTGGATCTCTTTTGAGACTGAAATCGTCACTGAAGACACTTGAGGGA
GAATCTTCTGAAAGCCCCGGCTCTGCGCATGATTCATCTTCTGGAATTTCCATGTGAATCACAGCTCTGC
ACCTGGATGGACTTTTGTTTGTGATATATTTTTTTTTTGGCCTGAACATTTGCTGCTAATGGAACTTACA
CAGAGTGCGGCTCTATGGAAGCCCAAGTTTCTTTGTTAATTTAAATGAAAAAGGGAGAGGGAGGGGAGGG
GAAACCCCTCCCACCCACCAAGTTTGGATCCTGGACCTCAGCTTGAACAGTATTCCAGTGAGGGCAAAGA
TTGGGTGGGGTTCTACTGCAGACATCCCCTTACCCAGTGCGGTATTGTCAACACCCCTCCCCCGTCCCCC
TCTTCCTCCAAGGCTTTGAGTTGGCTGCTGGCTAGCAAACTCCTTCTTACCCATTAAGTTATTTAATATA
ATAATGAAGCGCAACACTGTGGTAGGAAA
Notes:The probe template was PCR amplified from IMAGE:2631273 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2631273 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000486 same experiment
 EMAGE:31271 same embryo
 EMAGE:30316 same embryo
 EMAGE:30289 same embryo
 EMAGE:30286 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS