Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31291

Osbpl10 ( MGI:1921736)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291
euxassay_008182_01 euxassay_008182_02 euxassay_008182_03 euxassay_008182_04 euxassay_008182_05
EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291
euxassay_008182_06 euxassay_008182_07 euxassay_008182_08 euxassay_008182_09 euxassay_008182_10
EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291
euxassay_008182_11 euxassay_008182_12 euxassay_008182_13 euxassay_008182_14 euxassay_008182_15
EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291
euxassay_008182_16 euxassay_008182_17 euxassay_008182_18 euxassay_008182_19 euxassay_008182_20
EMAGE:31291 EMAGE:31291 EMAGE:31291 EMAGE:31291
euxassay_008182_21 euxassay_008182_22 euxassay_008182_23 euxassay_008182_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 15 16 17 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 22 23 24
ventral grey horn
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 06 07 18 19
testis
weak weak
regionalweak expression: see section 06 07 08 09 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T230
Entity Detected:Osbpl10, ( MGI:1921736)
Sequence:sense strand is shown

>T230
CTCAGCTTCGAGCGTGCGCCAAATACCACATGGAGATGAGTTCCAAGACTACTCCAGGCTCCCGCAGCCG
AAGCCTCACTTTGCTCCCCCATGGAACACCCAGTTCTGCGTCTCCCTGTAGCCAGAGACATCTCAGTACG
GGCGCCCCCGGTGTTGTCTCAGTCACGCGTCACAAGTCGCCTGCAGCTGCCCGAAGAGCCAAGAGTCAGT
ATTCCGGCCAGCTTCACGAAGTCAGAGAGATGATGAACCAGGTGGAAGGCCAGCAGAAGAACCTCGTGCA
TGCCATTGAGTCCCTGCCAGGCTCGGGCCCCCTCACTGCCTTGGACCAGGACCTGCTTCTCCTGAAGGCT
ACCTCTGCCGCCACCCTCAGCTGTCTCGGGGAGTGCCTCAGCCTGCTTCAGCAGAGTGTGCGCCAGGCAG
CGCCACCCAGCCACAAGCCAGGCGCCTCAGAGACCATCCTGGGATGGCATGGGCCC
Notes:The probe template was PCR amplified from IMAGE:2650570 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650570 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008182 same experiment
 EMAGE:31281 same embryo
 EMAGE:31290 same embryo
 EMAGE:31699 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS