Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31489

Capn10 ( MGI:1344392)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489
euxassay_000842_01 euxassay_000842_02 euxassay_000842_03 euxassay_000842_04 euxassay_000842_05
EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489
euxassay_000842_06 euxassay_000842_07 euxassay_000842_08 euxassay_000842_09 euxassay_000842_10
EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489
euxassay_000842_11 euxassay_000842_12 euxassay_000842_13 euxassay_000842_14 euxassay_000842_15
EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489 EMAGE:31489
euxassay_000842_16 euxassay_000842_17 euxassay_000842_18 euxassay_000842_19 euxassay_000842_20
EMAGE:31489 EMAGE:31489 EMAGE:31489
euxassay_000842_21 euxassay_000842_22 euxassay_000842_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
not examined not examined
regionalnot examined expression: see section 09
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 09 10 11 18 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T343
Entity Detected:Capn10, ( MGI:1344392)
Sequence:sense strand is shown

>T343
CCGGGCTAAGCAAACACGGTTTGCAGTGAAGGCCGCGCACTCGCTCCCGGGCGGCGACCGAGTCCACGGG
CCGCAGATGGGAGCCCAGGGCGCCGAAGATGCGGGCGGTCCGGGCCGAGACGCCGGCGCGGGAGCTCTTC
CGGGACGCGGCATTCCCCGCCTCGGACTCCTCGCTCTTTTACAACTTGTCCACGCCTCTGGCCCAGTTTC
GGGAGGACATCACTTGGAGACGACCCCAGGAAATCTGTGCCACACCTCAGCTGTTTCCAGATAACCCATG
GGAGGGACAGGTGAAGCAAGGGCTGCTGGGAGATTGCTGGTTCCTGTGTGCCTGTGCCGCCCTTCAGAAG
AGTCAACACCTCCTGGACCAGGTCTTCCCTCCAGGACAGCCAGGCTGGTCTGACCAGAAATACCAAGGCT
TCTTCACCTGTCGGATTTGGCAGTTTGGACACTGGGAGGAAGTGACCATAGATGATCGTCTGCCTTGTCT
TGCCGG
Notes:The probe template was PCR amplified from IMAGE:3154780 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154780 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000842 same experiment
 EMAGE:31823 same embryo
 EMAGE:30110 same embryo
 EMAGE:31567 same embryo
 EMAGE:31512 same embryo
 EMAGE:30742 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS