Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31567

4930430F08Rik ( MGI:1921197)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567
euxassay_000838_01 euxassay_000838_02 euxassay_000838_03 euxassay_000838_04 euxassay_000838_05
EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567
euxassay_000838_06 euxassay_000838_07 euxassay_000838_08 euxassay_000838_09 euxassay_000838_10
EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567
euxassay_000838_11 euxassay_000838_12 euxassay_000838_13 euxassay_000838_14 euxassay_000838_15
EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567 EMAGE:31567
euxassay_000838_16 euxassay_000838_17 euxassay_000838_18 euxassay_000838_19 euxassay_000838_20
EMAGE:31567
euxassay_000838_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 15 16 17
facial vii ganglion
weak weak
homogeneousweak expression: see section 03 17
medulla oblongata basal plate
weak weak
homogeneousweak expression: see section 06 08 13 14 15
thymus primordium
weak weak
homogeneousweak expression: see section 11 12 13 14
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 03 04 05 06 15 16 17 18 19 20
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 08 09 11 12 14 15 17 18 19 20
liver lobe
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 08 09 11 12 13 14 15 16 17 18 19 20 21
vestibulocochlear viii ganglion vestibular component
weak weak
homogeneousweak expression: see section 04 05 06 17 18
superior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 16
vestibulocochlear viii ganglion cochlear component
weak weak
homogeneousweak expression: see section 05 17
inferior glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 06 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T176
Entity Detected:4930430F08Rik, ( MGI:1921197)
Sequence:sense strand is shown

>T176
GCAGTTAGGATCTTCTGGCTGGTGTTTGGATTCTAGCTCATTTCTGCAGACTTCCTCCGCCCGGGGCCCA
GCGCAGTGGAGACAGGTTGCGCGTGGGCAACATGAAGCGCCTGGGCTCGGTGCAGCGGAAGATGCCGTGT
GTGTTTGTGACGGAGGTGAAAGCTGAGCCTTCAGCCAAGCGGGAGCATCAGCCATTTAAAGTTTTGGCAA
CTGAAACTCTAAGTGAAAAGGCGTTAGATGCAGACGTGTACAATGCGGTTGCAACAGAAAAAGTGGATGG
AACATGCTGCTATGTTACTAACTACAAAGGTCAGCCATACCTTTGGGCTCGACTAGATAGAAAACCTAAC
AAGCAGGCTGACAAGAGATTTAAAAAATTTCTACATTCAAAAGAAAGTGCAAAAGAGTTTCACTGGAACA
CTGAGGAAGACTTCAAGCCTGTCCCAGAGTGCTGGATACCAGCA
Notes:The probe template was PCR amplified from IMAGE:2646347 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2646347 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000838 same experiment
 EMAGE:31823 same embryo
 EMAGE:30110 same embryo
 EMAGE:31512 same embryo
 EMAGE:30742 same embryo
 EMAGE:31489 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS