Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31499

Stk10 ( MGI:1099439)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499
euxassay_011746_01 euxassay_011746_02 euxassay_011746_03 euxassay_011746_04 euxassay_011746_05
EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499
euxassay_011746_06 euxassay_011746_07 euxassay_011746_08 euxassay_011746_09 euxassay_011746_10
EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499
euxassay_011746_11 euxassay_011746_12 euxassay_011746_13 euxassay_011746_14 euxassay_011746_15
EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499
euxassay_011746_16 euxassay_011746_17 euxassay_011746_18 euxassay_011746_19 euxassay_011746_20
EMAGE:31499 EMAGE:31499 EMAGE:31499 EMAGE:31499
euxassay_011746_21 euxassay_011746_22 euxassay_011746_23 euxassay_011746_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart ventricle
strong strong
spottedstrong expression: see section 07 08 09 10 11 17 moderate expression: see section 12 13 14 15 16 18
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08
metanephros
strong strong
spottedstrong expression: see section 04 05 06 07 08 09 14 15
spinal cord
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08
left lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
anterior naris epithelium
strong strong
spottedstrong expression: see section 12 13 16
tongue muscle
strong strong
spottedstrong expression: see section 10 11 12 13 14 15 16 17
external naris epithelium
strong strong
spottedstrong expression: see section 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 09
vertebral axis musculature
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 19 20 21 22 23
nasal cavity olfactory epithelium
strong strong
spottedstrong expression: see section 08 09 10 11 12 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37087
Entity Detected:Stk10, ( MGI:1099439)
Sequence:sense strand is shown

>T37087
TACTAATGACATCACCGCGAACGCATCCTTATTGTGATCCTTGTGGGTTTTTTGTTTGTTTGTCTGTTTG
TTTGTTTGCCTTCAGTAATTCCTCACAGTGTCGGGAAACATCCTTAAGAGCCACTTGGGTTCTCAGCAGC
CAGGTCCCGGGTGTCCCCATTCCCTTGTTTCACATAGCTGACTTTGCTTTGTGTATGTCGGGGTAGGGAG
CGTGGAGAAGGATGCCAGAGATGCCTGTTCTGCTGATTCTGACATTGTATCCCATCTTATTTTCCTCTCC
CTGTGAGACATGCGATACACACACACACACACACACACACACACACACACACACACTGCAAATACATAAC
TTGGCCCCCCTGACACCACCCAGGCTGCCTCTGCTGTGACCTCCTAGGACCAATGCATTGGAACCTGCTT
GCTTGCCTCCTGAGCCTGATCCAGGGCCACTGAGCATGTCAGGTGGAGCAGCTGGTGGGGCCATGCTGAG
TGCTGGCGCCAGAACCCAGAGAAGGCACAGGCTGTACTGCCAGCCTGCAACTCATTTGGCTGCACACAGG
ATCCCGTGTTCAGGGGTACACCCCCCTCCACACTTGACTTCTGCTGCCTAGCACGTGCCAATCTCACCCT
TGCCCGCTTGTCTGCAGGTACCCAGGAAGGCTTTTGACTTCTGCCCTAGTCCTGTACTGGAGTCCCACTG
TACATTTCCACTAAGCTTTGGACTTCTCTGTTCAGGAAGAACTGTTCCCCACCCTCAGGAACATGCTGCG
CTCAGGGAAATGTGGAGCCTCCATGACTGGGCCTTCGGGCTGCTCAGGTAGCCTCCCAAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98634. Forward Primer - name:098634_F_cDNA_Stk10, sequence:TACTAATGACATCACCGCGAAC; Reverse Primer - name:098634_N_SP6_cDNA_Stk10, sequence:CTCTTGGGAGGCTACCTGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011746 same experiment
 EMAGE:30428 same embryo
 EMAGE:30614 same embryo
 EMAGE:31536 same embryo
 EMAGE:31888 same embryo
 EMAGE:30411 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS