Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31888

Stra8 ( MGI:107917)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888
euxassay_011751_01 euxassay_011751_02 euxassay_011751_03 euxassay_011751_04 euxassay_011751_05
EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888
euxassay_011751_06 euxassay_011751_07 euxassay_011751_08 euxassay_011751_09 euxassay_011751_10
EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888
euxassay_011751_11 euxassay_011751_12 euxassay_011751_13 euxassay_011751_14 euxassay_011751_15
EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888 EMAGE:31888
euxassay_011751_16 euxassay_011751_17 euxassay_011751_18 euxassay_011751_19 euxassay_011751_20
EMAGE:31888 EMAGE:31888
euxassay_011751_21 euxassay_011751_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 06 07 08 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 19
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21
spleen primordium
strong strong
regionalstrong expression: see section 02 03 04
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37092
Entity Detected:Stra8, ( MGI:107917)
Sequence:sense strand is shown

>T37092
CAGCTTAGAGGAGGTCAAGGAAGAATATGCCAGAATGTATTCCGAGAATGACAGTGTATTCCTAAACAGT
TTTCTTCAGGACAGTCCCCCTGAGTGGTTCCCCTCTGAGGCTGTTGGACCAGATGCTGAAGAAGAAGGAG
AAGAAGAAGGAGAAGAAGAAGGAGAAGAAGGAGAAGAAGAAGAGGAAGGAGACGAAGAAGGAGAAGAAGA
AGAAGAAAACGGTGAAGAGAGAGAGGTAGAGGAGTACCAGGAAGAGGAAGAAGAAGAAGAGGAGGAGGAG
AAAAAAGTCGATCTCTCCCACTCCTCCTCCACTCTGTTGCCGGACCTCATGGAATTTGAACGGTATCTCA
ACTTTTACAAGCAGACCATGGACCTCCTGACCATGAACAGCATCATCTCTGCACATGAAGTGACACTTCC
TATTGTCTCTGCCGCCATCTCCCACCTGTGGCAGACTCTCTCTGAGGAGAAAAAGGCCAGACTCCTGCAG
GTGTGGGAACAGCAGCACAGCGCCTTCGCAGACCTCACCGAGGCCTGTCTAGAGCTGGCCGGGGTGGAGG
GCAGCATGAAGGACAGCGGCGTGGACAGCCAGGGAGCGAGCTGCTCGCTGGAGTCCACCCCAGAAGAGAT
CCTTTTTGAAGATGCTTTTGACGTGGCAAGTTTCCTGGACAAGAGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74162. Forward Primer - name:074162_F_cDNA_Stra8, sequence:CAGCTTAGAGGAGGTCAAGGAA; Reverse Primer - name:074162_N_SP6_cDNA_Stra8, sequence:TCACTCTTGTCCAGGAAACTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011751 same experiment
 EMAGE:30428 same embryo
 EMAGE:30614 same embryo
 EMAGE:31499 same embryo
 EMAGE:31536 same embryo
 EMAGE:30411 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS