Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31592

Ppap2b ( MGI:1915166)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592
euxassay_006582_01 euxassay_006582_02 euxassay_006582_03 euxassay_006582_04 euxassay_006582_05
EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592
euxassay_006582_06 euxassay_006582_07 euxassay_006582_08 euxassay_006582_09 euxassay_006582_10
EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592
euxassay_006582_11 euxassay_006582_12 euxassay_006582_13 euxassay_006582_14 euxassay_006582_15
EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592 EMAGE:31592
euxassay_006582_16 euxassay_006582_17 euxassay_006582_18 euxassay_006582_19 euxassay_006582_20
EMAGE:31592
euxassay_006582_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
interdigital region between forelimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 04 19 20 21 weak expression: see section 03
metencephalon rest of alar plate ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 16 17 moderate expression: see section 03 09 10 11 12 14 15 18
metanephros
moderate moderate
regionalmoderate expression: see section 08 09 16 17
male reproductive system
moderate moderate
regionalmoderate expression: see section 11
interdigital region between forelimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 02
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19 20 21 weak expression: see section 04
bladder
weak weak
regionalweak expression: see section 11 12 13
diaphragm
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19
interdigital region between forelimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 04 19 20 21 weak expression: see section 03
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 08 09 10 19 20 21 weak expression: see section 07
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 14 15 16 17 18 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
upper lip
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 15 16
lower lip
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19 21 weak expression: see section 04
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 14 15 moderate expression: see section 10 11 12
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 04 05 20 21
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 12
palatal shelf
moderate moderate
regionalmoderate expression: see section 09 11 12 13 14 15 weak expression: see section 10
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19 weak expression: see section 04
interdigital region between forelimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 04 19 20 weak expression: see section 03
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 moderate expression: see section 11 12 13 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19 20 weak expression: see section 04
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 13
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 13
glans of male genital tubercle
moderate moderate
regionalmoderate expression: see section 12 13 14 15 weak expression: see section 11
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 moderate expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6859
Entity Detected:Ppap2b, ( MGI:1915166)
Sequence:sense strand is shown

>T6859
AGCGATCACAGCGGCAGCCCGGGCGGCAGCAGCAGGAGGAGGAGGAGCAGGAGGAGGAGGCAGAGTTGGA
GTTGGGCAGACGCTGAGGAGAGCTAGCTGCAGGACGCTGCGGAGTTGCAGGGCTCCGCGCTGCTCCATTC
ATTAAGTAGCTGCGGAGGATCGTGGCGGGACGCCGACGCTGCCCACTCGCAAACTCCAGCACGCAGACGC
ACGCCAGCCGGACGCGTCCGGGGCAGCACAGTTCTGCAAAAGTTCCTGCTCGGGATTTGGCTCTCTTCCC
CTTGGACTAGCGAACAGTTTGGGGTTGAGAGGAAAGCAGAGGCGCCCAGAGGGGAAACCTACCCGCGTCT
GCAGTTGGAACTACTCCGCCGGGCTGCACTCTCGCCGCCGCGTCCCGAGCCCGCATACCCGCTCCTGAGC
AGCGGCGGCCCGCATCGCCCCGGGAGGCTCCCCGCAGCCAGCGCCATGCAAAGCTACAAGTACGACAAGG
CGATCGTCCCTGAGAGTAAGAACGGCGGCAGCCCGGCGCTCAACAACAACCCGAGGAAGGGCGGCAGCAA
GCGGGTGCTGCTCATCTGCCTGGACCTCTTCTGCCTCTTCATGGCGGCTCTGCCCTTCCTCATCATCGAG
ACAAGCACCATTAAGCCTTACCGTCGAGGGTTTTACTGCAATGACGAGAGCATCAAGTATCCCCTGAAAG
TCAGTGAGACTATAAACGATGCTGTGCTCTGTGCGGTGGGGATCGTCATCGCCATCCTGGCGATCATTAC
AGGGGAATTCTACCGGATCTATTACCTCAAGGAGAAGTCCCGCTCCACCACTCAGAACCCGTATGTGGCA
GCTCTCTATAAGCAAGTGGGATGCTTCCTTTTCGGCTGTGCCATTAGCCAGTCCTTCACCGACATCGCCA
AAGTGTCCATCGGGCGCCTGAGGCCTCACTTCCTGAGCGTCTGTGACCCTGATTTCAGTCAGATCAATTG
CTCCGAGGGCTACATTCAGAACTACAGGTGCAGAGGAGAAGACAGCAAAGTACAGGAGGCCAGGAAGTCC
TTCTTCTCGGGCCACGCCTCCTTCTCCATGTTCACTATGCTGTATCTGGTGCTCTACCTTCAGGCCCGCT
TCACCTGGCGCGGGGCCCGACTGCTCCGCCCCCTCCTGCAGTTCACTTTGCTCATGATGGCCTTCTACAC
GGGATTGTCACGGGTATCTGACTACAAGCATCATCCTAGCGATGTCCTGGCAGGATTTGCCCAAGGAGCT
CTGGTGGCCTGCTGCATAGTGTTCTTCGTGTCCGACCTCTTCAAGACTAAGACGAGCCTCTCACTGCCCG
CCCCTGCGATCAGGAGGGAGATCCTGTCTCCCGTGGACATCATCGACAGGAACAATCACCATAACATGGT
GTAGATGCTGCGGCCTCCGGAGCGCTTTCTCTGAAGCGACTGCACGTTCCTGCTGCTCTCCGATCTCATC
AGACAGTAGAATGTAGGGAAAAGCTTTTGCCCGATGGATTTTGAAAACATTTAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3964817 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3964817 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006582 same experiment
 EMAGE:29617 same embryo
 EMAGE:30333 same embryo
 EMAGE:31635 same embryo
 EMAGE:29601 same embryo
 EMAGE:31588 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS