Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31621

1810057P16Rik ( MGI:1914872)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621
euxassay_006355_01 euxassay_006355_02 euxassay_006355_03 euxassay_006355_04 euxassay_006355_05
EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621
euxassay_006355_06 euxassay_006355_07 euxassay_006355_08 euxassay_006355_09 euxassay_006355_10
EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621
euxassay_006355_11 euxassay_006355_12 euxassay_006355_13 euxassay_006355_14 euxassay_006355_15
EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621
euxassay_006355_16 euxassay_006355_17 euxassay_006355_18 euxassay_006355_19 euxassay_006355_20
EMAGE:31621 EMAGE:31621 EMAGE:31621 EMAGE:31621
euxassay_006355_21 euxassay_006355_22 euxassay_006355_23 euxassay_006355_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 17 18 19
not examined not examined
regionalnot examined expression: see section 01 02 03 21 22 23
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
cervical ganglion
weak weak
regionalweak expression: see section 07 08 15 16 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 09 15 16
thoracic ganglion
weak weak
regionalweak expression: see section 11
retina
weak weak
regionalweak expression: see section 01 02 03 21 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35017
Entity Detected:1810057P16Rik, ( MGI:1914872)
Sequence:sense strand is shown

>T35017
TCATGAAGGACAACAAGGACACCTTTGGCGAGATGTCAGACGGGGACATGCAGGAGCAACTCCGACTCTA
TGACATGTAGGCCTGTCACCCGGCAAGATGTGACCCAGGACATCATGACAACTCTGAGGGACTCGGCCCA
GGCAGTTAGTTGTGACTCCCAGACCTTTGTTTGAAAGACTGTCTTATAAAAACAGAGAGACCTATGTTAT
GTAAGGATCTGCAATTTATATATCACATCAGAGGAACCTACATCATTTCTTCAGGGAGGAAACCCCAGAT
CGCCCTGGCTTCAGCTTGCTGGTGTGGGTTCAGCTGGGCCGTGTTCTACAGACTCAGAGTGGGTGGGCCA
GGGGAGATGATGAGACTCGGTGTTTGGCACCTAAGTATTTAGTGTAGACAAAATACGGGGCGCTATGGGG
GGAGGATATAGGTGTGATCTAGTAACACCACACTCTTCATTCTGCCCTAGGGTTATTTCTGGAAGCATCT
GGGGTGGTAGTTGAAGCAAGCAGTAGAGGAGCAATATTTTAGTAAATGTCTGATTGAAAGGTCCAGCCAT
CACCCTGGGGCAGAACCGTGGGGTCACTGCTGAAGCTTGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83411. Forward Primer - name:083411_F_cDNA_1810057P16Rik, sequence:TCATGAAGGACAACAAGGACAC; Reverse Primer - name:083411_N_SP6_cDNA_1810057P16Rik, sequence:GACAAGCTTCAGCAGTGACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006355 same experiment
 EMAGE:32111 same embryo
 EMAGE:31559 same embryo
 EMAGE:31586 same embryo
 EMAGE:30711 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS