Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31637

3110006E14Rik ( MGI:1924230)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637
euxassay_007895_01 euxassay_007895_02 euxassay_007895_03 euxassay_007895_04 euxassay_007895_05
EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637
euxassay_007895_06 euxassay_007895_07 euxassay_007895_08 euxassay_007895_09 euxassay_007895_10
EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637
euxassay_007895_11 euxassay_007895_12 euxassay_007895_13 euxassay_007895_14 euxassay_007895_15
EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637
euxassay_007895_16 euxassay_007895_17 euxassay_007895_18 euxassay_007895_19 euxassay_007895_20
EMAGE:31637 EMAGE:31637 EMAGE:31637 EMAGE:31637
euxassay_007895_21 euxassay_007895_22 euxassay_007895_23 euxassay_007895_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16 17 18 19 20 21 22 23 24
dorsal root ganglion
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 03 04 05 06 07 08 09 10 11 12 13
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 04 18 19 20
midbrain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16 17 18 19
diencephalon
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 weak expression: see section 16 17 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 04 05 06 07 08 16 17 18 19 20 21
hindbrain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 16 17 18 19
spinal cord
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35604
Entity Detected:3110006E14Rik, ( MGI:1924230)
Sequence:sense strand is shown

>T35604
TCTTCCACCCTTTTCTACTCCAGCCAGAACTGTGTTCTGAATGCAAAGGACACACTTAAGTTATTTATGA
ACTGACGTGTTTACAGAGAGAAAGAGCAAACTGTTTGGGATTACATTTCCATAATAAATGACCGTCTCTA
AGTCACTTTAGAACACATGCGAGTTGACGACTTTCCCCAGTCCACCTCCCCTCTGCCCACCTGTCGAATC
TCCCTTAGCTTCTTTCCACGACAGCAGCCTTGAGCAGCCCGGAGGGAACTCAGTGCCCCGCCCACTCCAT
TTCCATATACAAAGGGGCTGTTAGCAAGTCAAGAGAGCCGCACATCACTGGGCCGGCCAGCCCCTGTTTG
CTGAGATCTCTGTTTCTCTATCTGGCAGGTCGACATAACTTGAAGATGTATCTTTCTTTCTGTGGCCTGT
GGTCTTCTGTGATGACATTTAGACCTCATTCATGCTATGACCTTTGGCTCATAAGAACACAAATCTAACA
TTGCCAGGTTTTAGTGTTGACTTAAAAGTACAACTGCCCACTTGATTAAAATGTGCTCCCATGCTTATCT
TGTTCTGTGCTGCTGTTCGAAGATAAACCTGTGCCATTTGATGAGAGGCAGGGGATGCTGCGGCCACCAG
GGGGGGTTCAGGACATGAGGTGCCCCTCCCTGGGTGCTCAGATCAGCAGATGGCCAGAGGGACAGTCTCT
TCAGACATTAGGGAACGCTCCAGCAACAGTGCTTCTGTGTCTGTCTCCTCTCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84396. Forward Primer - name:084396_F_cDNA_3110006E14Rik, sequence:TCTTCCACCCTTTTCTACTCCA; Reverse Primer - name:084396_N_SP6_cDNA_3110006E14Rik, sequence:CTGAGAGGAGACAGACACAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007895 same experiment
 EMAGE:30239 same embryo
 EMAGE:30241 same embryo
 EMAGE:30173 same embryo
 EMAGE:29621 same embryo
 EMAGE:30238 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS