Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31673

Slc25a31 ( MGI:1920583)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673
euxassay_008163_01 euxassay_008163_02 euxassay_008163_03 euxassay_008163_04 euxassay_008163_05
EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673
euxassay_008163_06 euxassay_008163_07 euxassay_008163_08 euxassay_008163_09 euxassay_008163_10
EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673
euxassay_008163_11 euxassay_008163_12 euxassay_008163_13 euxassay_008163_14 euxassay_008163_15
EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673 EMAGE:31673
euxassay_008163_16 euxassay_008163_17 euxassay_008163_18 euxassay_008163_19 euxassay_008163_20
EMAGE:31673 EMAGE:31673 EMAGE:31673
euxassay_008163_21 euxassay_008163_22 euxassay_008163_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 09 10 11 12 13 15 16 17 18 19 20 21 weak expression: see section 01 02 03 04 22
right lung
moderate moderate
spottedmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22
pituitary gland
moderate moderate
spottedmoderate expression: see section 13 14 15 17 weak expression: see section 12 16
urethra of male
weak weak
spottedweak expression: see section 10 11 12
testis
moderate moderate
regionalmoderate expression: see section 04 05 06 07 19 20 weak expression: see section 21
left lung
moderate moderate
spottedmoderate expression: see section 05 06 07 09 10 11 weak expression: see section 04
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T29
Entity Detected:Slc25a31, ( MGI:1920583)
Sequence:sense strand is shown

>T29
TCCNNACANCTGTGGCGCCCATCGAGCGTGTGAAGCTGCTGCTGCAGGTGCAGGCGTCCTCCAAGCAGAT
AAGCCCTGAGGCGCGCTACAAGGGCATGCTGGACTGCCTGGTGCGCATTCCTCGTGAGCAAGGATTTTTA
AGTTATTGGCGTGGCAATTTGGCAAATGTTATTCGATACTTTCCAACACAAGCCTTAAACTTCGCTTTTA
AGGACAAATACAAAGAACTTTTCATGTCTGGTGTTAATAAAGAAAAACAGTTCTGGAGATGGTTTCTAGC
AAACCTGGCTTCTGGAGGGGCTGCTGGAGCAACATCCTTGTGTGTAGTATACCCACTAGATTTTGCCAGA
ACCCGATTAGGTGTTGATATTGGAAAAGGTCCTGAGCAGCGGCAGTTCACGGGTTTGGGTGACTGCATTA
TGAAAATAGCCAAGTCAGATGGACTGATTGGTCTATACCAAGGGTTTGGTGTCTCTGTTCAGGGTATCAT
TGTTTACCGAGCCTCTTACTTTGGAGCTTATGACACCGT
Notes:The probe template was PCR amplified from IMAGE:944172 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:944172 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008163 same experiment
 EMAGE:31675 same embryo
 EMAGE:29940 same embryo
 EMAGE:31760 same embryo
 EMAGE:31683 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS