Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31760

Lhfpl2 ( MGI:2145236)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760
euxassay_008159_01 euxassay_008159_02 euxassay_008159_03 euxassay_008159_04 euxassay_008159_05
EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760
euxassay_008159_06 euxassay_008159_07 euxassay_008159_08 euxassay_008159_09 euxassay_008159_10
EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760
euxassay_008159_11 euxassay_008159_12 euxassay_008159_13 euxassay_008159_14 euxassay_008159_15
EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760
euxassay_008159_16 euxassay_008159_17 euxassay_008159_18 euxassay_008159_19 euxassay_008159_20
EMAGE:31760 EMAGE:31760 EMAGE:31760 EMAGE:31760
euxassay_008159_21 euxassay_008159_22 euxassay_008159_23 euxassay_008159_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 24
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 05 06 07 08 09
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T47
Entity Detected:Lhfpl2, ( MGI:2145236)
Sequence:sense strand is shown

>T47
TTTTTTTTTTTTTTGTGTAGCACTAAAATTGTTACTCTAATATGACTAGCCATGAAGGCAAAAATGTTTT
TTAACTCCCCTTTGCCACAAAAGAAACATCCCTGTTTTGATTCTTGTCCAGTTTCCCCAAAGAAAACATA
CATACACCTTGGTTATTGCACATCTATTAGACAAACTTGTATATGTGTAATATATATACTTAAATATGCT
ACACATAACAAAAAAGACTATGGCACTTTACAGAATACATGTTTGACAAAGGCCATTCATTACACCACAG
ATACTTCAAAGACCCTTCCACAGTTATAATGTAACGTTGAATTAGCACACAGGTTTAAAGAAGCCACAGA
CCCCCAAGTGTTTGTGCTGTATATCAATGAGAAGCTGAGCACAGATGCAGGCAGAATACTTGTCTGGTCC
TAGTGATGGTTCTATGTCAGAGAAACGGGTATCGGCCCAGCAAGTGGTCGTGAAGAGCCAGGAGAGAAGT
TCCATTCTATGTTAGCACAATTGCA
Notes:The probe template was PCR amplified from IMAGE:961715 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:961715 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008159 same experiment
 EMAGE:31675 same embryo
 EMAGE:31673 same embryo
 EMAGE:29940 same embryo
 EMAGE:31683 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS