Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31753

Brunol4 ( MGI:1932407)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753
euxassay_009241_01 euxassay_009241_02 euxassay_009241_03 euxassay_009241_04 euxassay_009241_05
EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753
euxassay_009241_06 euxassay_009241_07 euxassay_009241_08 euxassay_009241_09 euxassay_009241_10
EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753
euxassay_009241_11 euxassay_009241_12 euxassay_009241_13 euxassay_009241_14 euxassay_009241_15
EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753 EMAGE:31753
euxassay_009241_16 euxassay_009241_17 euxassay_009241_18 euxassay_009241_19 euxassay_009241_20
EMAGE:31753
euxassay_009241_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 11 12
neural retina
strong strong
regionalstrong expression: see section 04 moderate expression: see section 02 03
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 12
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 14 15 16 17 18
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 06 13 14
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14
brain
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 06 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3499
Entity Detected:Brunol4, ( MGI:1932407)
Sequence:sense strand is shown

>T3499
ACAGGCTCAAGGTGCAGCTGAAGCGGCCCAAAGACGCCAATCGCCCGTACTGAGCGCCGGCGGGAGCGTC
CCCCGGGGGAGACCAGGACTCGCACAGGGCAGGATGCTGAACGGGCTACATTAAAAACAAACCTCTTTCT
CTCTCTATTTATAAATGAGAACTGTTGGACGACACCTTTGACATATCAGCCAATACCAATCAAGCTGACG
ACTCCAGACACTCCGTGTGACTGTAACATTTCTTCAAGGAAAGTATAGCGTCTATGGAGTGCAGAGGGCA
TGTGTTTGGGGAAAAATATACATGACATAAAGATGACGACGAAGAAGAAAAATGATATAAAACAAACAAA
AAACCCGCGACTTTAAAATGAAATAACGTGAGCCCAGATGGGGAAGCTGAAGGGCTGGGCACTAGGAGGA
GATGCTGCTGCCAACCGATCCTGGGGCTTTTCCCGCCCGTAGGCGCCTGAGGCAGGCAGGGGCAAGTGTA
CAATGGGGCCTAGTCCCCAGCAGGCGGCTGGG
Notes:The probe template was PCR amplified from IMAGE:335274 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:335274 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009241 same experiment
 EMAGE:31040 same embryo
 EMAGE:29824 same embryo
 EMAGE:29823 same embryo
 EMAGE:29536 same embryo
 EMAGE:29701 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS