Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31766

Tbrg1 ( MGI:1100877)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766
euxassay_001972_01 euxassay_001972_02 euxassay_001972_03 euxassay_001972_04 euxassay_001972_05
EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766
euxassay_001972_06 euxassay_001972_07 euxassay_001972_08 euxassay_001972_09 euxassay_001972_10
EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766
euxassay_001972_11 euxassay_001972_12 euxassay_001972_13 euxassay_001972_14 euxassay_001972_15
EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766 EMAGE:31766
euxassay_001972_16 euxassay_001972_17 euxassay_001972_18 euxassay_001972_19 euxassay_001972_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 12 13 14 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 04 05 13 14 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 04 07 13 14 15 16 17
basisphenoid bone
strong strong
regionalstrong expression: see section 05 06 13 15 16
lower jaw incisor
strong strong
regionalstrong expression: see section 05 06 07 08 10 11 12 13
upper jaw incisor
strong strong
regionalstrong expression: see section 05 06 10 11 12 13
frontal bone primordium
strong strong
regionalstrong expression: see section 01 02 03 04 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 13 15 16 17 18 19 20
viscerocranium
strong strong
regionalstrong expression: see section 07 08 09 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T736
Entity Detected:Tbrg1, ( MGI:1100877)
Sequence:sense strand is shown

>T736
CTCGAGNCTGTTGGCCTACTGGGAATCGACTGGGAAGTGCCGAGGATCGCCATCTGTTTCTGCCTGCGCT
CCATCCCCTCCGCGCCCCGGAGCTCCAGAACCCGGTCTGATCATGAGCGTGTTGAGCGGCCTGGCCTCCG
AGCCGCGCACCCCGCTGTCCAGCAAGGCTAGGATGAAAAGGCTCCCGAGGAAGAGCCAGAACGAGAAGTA
CCGGCTGAAGTACCTGCGGCTGCGCAGAGCAGCTAAGGCCACGGTGTTTGAAAATGCTTCCATCTGTGAT
GAAATTGCTCGTCTTGAGGAAAAATTTCTTAAAGCAAAGGAAGAAAGAAGATACTTGCTGAAGAAGCTCC
TCCAGATACATGCTCTAACTGAAGGGGAGCCACAGGCCGCTGCTCCTTCCCACAGCTCCAGTTTGCCCCT
GCCTTATGGTGTCACCAGCTCTGTGGGAACTATGCAGGGAGCCGGGCCCAGCACTGGGGCCGAGGAACCA
TTTGCGAAGAAATCCAAGAAGGAGAAGAAAGAAAAGGGCAAGGAGAACAGCAAACTGGAAGT
Notes:The probe template was PCR amplified from IMAGE:1890714 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1890714 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001972 same experiment
 EMAGE:31839 same embryo
 EMAGE:31565 same embryo
 EMAGE:31399 same embryo
 EMAGE:31870 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS