Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31832

Mat2b ( MGI:1913667)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832
euxassay_000623_01 euxassay_000623_02 euxassay_000623_03 euxassay_000623_04 euxassay_000623_05
EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832
euxassay_000623_06 euxassay_000623_07 euxassay_000623_08 euxassay_000623_09 euxassay_000623_10
EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832
euxassay_000623_11 euxassay_000623_12 euxassay_000623_13 euxassay_000623_14 euxassay_000623_15
EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832
euxassay_000623_16 euxassay_000623_17 euxassay_000623_18 euxassay_000623_19 euxassay_000623_20
EMAGE:31832 EMAGE:31832 EMAGE:31832 EMAGE:31832
euxassay_000623_21 euxassay_000623_22 euxassay_000623_23 euxassay_000623_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 01 02 03 04 05 06 08 18 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T410
Entity Detected:Mat2b, ( MGI:1913667)
Sequence:sense strand is shown

>T410
CATCCCTAGCCGGCGGGTTCTCATTACTGGTGCCACTGGGCTTCTTGGCAGAGCAGTTTACAAAGAGTTT
CAGCAGAGCAACTGGCACACCGTTGGCTGTGGCTTTCGAAGAGCAAGACCAAAATTCGAACAAGTGAACC
TGTTGGATTCTGAAGCTGTTCATCACCTCATTCATGATTTCCAGCCTCATGTCATAGTGCATTGTGCTGC
AGAGAGAAGACCTGATGTTGTTGAGAGTCAGCCAGATGCTGCTTCCCAGCTGAATGTGGGTGCCTCTGGG
AACTTGGCAAAGGAGGCAGCTGCGATTGGAGCATTTCTCATCTACATTAGCTCAGATTATGTGTTTGATG
GCACAAATCCCCCTTACACAGAAGAAGATATACCAAGTCCCCTGAATCTATATGGAAAAACAAAATTAGA
TGGAGAAAAAGCAGTCCTGGAGAATAATTTAGGGGCTGCTGTGTTGAGAATTCCTGTTCTGTATGG
Notes:The probe template was PCR amplified from IMAGE:3157456 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157456 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000623 same experiment
 EMAGE:32022 same embryo
 EMAGE:30080 same embryo
 EMAGE:31515 same embryo
 EMAGE:31526 same embryo
 EMAGE:30186 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS