Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31834

Aadat ( MGI:1345167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834
euxassay_000865_01 euxassay_000865_02 euxassay_000865_03 euxassay_000865_04 euxassay_000865_05
EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834
euxassay_000865_06 euxassay_000865_07 euxassay_000865_08 euxassay_000865_09 euxassay_000865_10
EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834
euxassay_000865_11 euxassay_000865_12 euxassay_000865_13 euxassay_000865_14 euxassay_000865_15
EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834 EMAGE:31834
euxassay_000865_16 euxassay_000865_17 euxassay_000865_18 euxassay_000865_19 euxassay_000865_20
EMAGE:31834 EMAGE:31834 EMAGE:31834
euxassay_000865_21 euxassay_000865_22 euxassay_000865_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
kidney pelvis
strong strong
regionalstrong expression: see section 22
liver lobe
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
kidney calyx
strong strong
regionalstrong expression: see section 10 11 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T983
Entity Detected:Aadat, ( MGI:1345167)
Sequence:sense strand is shown

>T983
TCTCGAGNCTGTTGGCCTACTGGTATTTAGATCTCAGACACCTACCGCAGCCGGTAGGCAGGCAGATTGG
GTGGCACTACACAGGGACAGCTAACAGTGCATCCCGAGTGACTGGCTTTCTGAATCCTGCTCCACGCGAC
CAGCAGAGACATGAATTACTCACGGTTCCTCACTGCAACGAGCCTGGCCAGAAAGCCATCTCCCATCAGA
ACTACAGCGGACATACTGAGCAAAGCACCAAAAACCCTCATCTCCCTGGCTCCTGGATCTCCAAACCCGA
GCATGTTCCCCTTTAAGTCAGCTGCCTTCACTGTGGAAAACGGAAGCACCATCCGGTTTGAAGACGACTT
GATCAAAAGGGCCCTCCAATACTCTCCAAGCTATGGAATTCCAGAACTTCTGTCCTGGCTAAAACAGTTT
CAAGTAAAATTGCATAATCCCCCCACTGTCAACTACCCACCCAATCAAGGACAGATGGATCTCTGCATCA
CATCTGGCTGCCAAGATGGTCTCTGTAAGGCATTTGAAATGCTCATCAATCCTGG
Notes:The probe template was PCR amplified from IMAGE:1972515 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1972515 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000865 same experiment
 EMAGE:31516 same embryo
 EMAGE:31867 same embryo
 EMAGE:31840 same embryo
 EMAGE:30057 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS