Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31901

1500011H22Rik ( MGI:1916198)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901
euxassay_006178_01 euxassay_006178_02 euxassay_006178_03 euxassay_006178_04 euxassay_006178_05
EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901
euxassay_006178_06 euxassay_006178_07 euxassay_006178_08 euxassay_006178_09 euxassay_006178_10
EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901
euxassay_006178_11 euxassay_006178_12 euxassay_006178_13 euxassay_006178_14 euxassay_006178_15
EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901 EMAGE:31901
euxassay_006178_16 euxassay_006178_17 euxassay_006178_18 euxassay_006178_19 euxassay_006178_20
EMAGE:31901 EMAGE:31901
euxassay_006178_21 euxassay_006178_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 weak expression: see section 15
adenohypophysis
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 18 moderate expression: see section 13 14 15 16 17 19
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14
spinal cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T495
Entity Detected:1500011H22Rik, ( MGI:1916198)
Sequence:sense strand is shown

>T495
TCCTCNANNCTGTTGGCCTACTGGAAAGAGAAAGAGCCGAGAGCCGTTATCGGTTGGGCCTCCGGCGAAG
GCGGTTGCCTAGGTGATAGCGGATCGCGAATTACGCTCCGCGCCCCCGGGCCGCAGCACCGGTGCTTGGG
TTTGACACATAGGGTGACAACCGAAGGTCTGCAGGTCCTCTGAGGGTCTAGAATACTGAGGTGGATAAGG
AATACTTGCTTTAGGGTGCGTGTGGATGGATTTGCCCTGACGCGTCCTTGTCAGCGAGAGATGCCCAGGC
GCAGGAGCCTGGTTACCTGAGGTTCCTCCGCCCTCGGGTCTACAGCTCCAGGAACTCGGGTCTTCCTCCG
CACCATCCGGCGGCCACTTGAGCAGGGTCGGAGTGGGGAGAGCCGGAGGCCGCCGACTCAGAGCCGGTGT
GGTGCACGCGTGTGGACGGGATGCCGAGCCGTTGGCCCGGGGTCGCGGGGCCGCCCGCCTTGGCCCGGAC
GGAAGGCGGTGAAGGATCAGCTGGACATTCTTATCCCCAGAATTCCAAGGGCACTGGCG
Notes:The probe template was PCR amplified from IMAGE:1481316 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1481316 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006178 same experiment
 EMAGE:31813 same embryo
 EMAGE:31824 same embryo
 EMAGE:31781 same embryo
 EMAGE:30918 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS