Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31915

Kcnt1 ( MGI:1924627)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915
euxassay_016515_01 euxassay_016515_02 euxassay_016515_03 euxassay_016515_04 euxassay_016515_05
EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915
euxassay_016515_06 euxassay_016515_07 euxassay_016515_08 euxassay_016515_09 euxassay_016515_10
EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915
euxassay_016515_11 euxassay_016515_12 euxassay_016515_13 euxassay_016515_14 euxassay_016515_15
EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915 EMAGE:31915
euxassay_016515_16 euxassay_016515_17 euxassay_016515_18 euxassay_016515_19 euxassay_016515_20
EMAGE:31915 EMAGE:31915 EMAGE:31915
euxassay_016515_21 euxassay_016515_22 euxassay_016515_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
weak weak
single cellweak expression: see section 10 11 12 13 14
olfactory cortex mantle layer
moderate moderate
single cellmoderate expression: see section 12 13 14 15 17 18 19
metanephros
weak weak
regionalweak expression: see section 08 09 10
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07
testis
weak weak
regionalweak expression: see section 07 08 09 19
pons mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 weak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 weak expression: see section 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 19 20
cerebral cortex mantle layer
moderate moderate
single cellmoderate expression: see section 08 23 weak expression: see section 09 10 11
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 18 19 20 21
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 20 21 22 23 weak expression: see section 09 10 11
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 13 14 15 weak expression: see section 09 10 11 12
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 13 14 15 weak expression: see section 09 10 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38746
Entity Detected:Kcnt1, ( MGI:1924627)
Sequence:sense strand is shown

>T38746
CCTTGATACTACACCAGGCTCCGGCTACCTCTGTGCAATGAAGGTAACCGAGGACGACCTGTGGATCCGC
ACTTACGGCCGCCTCTTCCAGAAACTCTGCTCCTCCAGCGCCGAGATCCCCATCGGCATCTACAGGACCG
AGTGCCATGTCTTCTCGGAGCCCCATGACGTCAGAGCCCAGTCTCAGATCTCGGTGAACATGGAGGACTG
CGAGGATACTCGGGAGGCCAAGGGACCCTGGGGCACACGAGCTGCATCTGGCAGTGGCAGCACCCATGGC
CGTCACGGGGGCAGTGCTGACCCAGTGGAGCACCCACTACTACGTCGCAAGAGCCTGCAGTGGGCCCGCA
AGCTGAGTCGCAAGAGCACCAAGCAGGCAGGGAAGGCACCTGTGGCCACAGACTGGATCACCCAGCAGCG
GCTCAGCCTGTACCGACGCTCAGAGCGCCAGGAGCTCTCAGAGCTGGTCAAGAACCGAATGAAGCACCTG
GGACTGCCCACCACTGGCTATGAGGACGTAGCAAATTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163417. Forward Primer - name:163417_F_cDNA_mCG18756.1, sequence:CCTTGATACTACACCAGGCTCC; Reverse Primer - name:163417_N_SP6_cDNA_mCG18756.1, sequence:AAATTTGCTACGTCCTCATAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016515 same experiment
 EMAGE:31918 same embryo
 EMAGE:32208 same embryo
 EMAGE:32205 same embryo
 EMAGE:32234 same embryo
 EMAGE:32235 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS