Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31918

Scrt2 ( MGI:2139287)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918
euxassay_016519_01 euxassay_016519_02 euxassay_016519_03 euxassay_016519_04 euxassay_016519_05
EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918
euxassay_016519_06 euxassay_016519_07 euxassay_016519_08 euxassay_016519_09 euxassay_016519_10
EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918
euxassay_016519_11 euxassay_016519_12 euxassay_016519_13 euxassay_016519_14 euxassay_016519_15
EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918
euxassay_016519_16 euxassay_016519_17 euxassay_016519_18 euxassay_016519_19 euxassay_016519_20
EMAGE:31918 EMAGE:31918 EMAGE:31918 EMAGE:31918
euxassay_016519_21 euxassay_016519_22 euxassay_016519_23 euxassay_016519_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
weak weak
regionalweak expression: see section 03 04 05 06 24
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 09 14
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 13 14 17 18 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 07 09 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18 19 20
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 09 14 15 16 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 18
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 05 06 07 09 10 11 13 14 15 17 18 19 20 21
pons mantle layer
weak weak
regionalweak expression: see section 07 08 09 11 12 13 14 15 16 17 18 19 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 10 11 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 09 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 20 21
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 06 07 22 23 weak expression: see section 03 04 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 18 19 20 21 22 23 weak expression: see section 08 09 10
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 21 22 23 24 weak expression: see section 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 07 08 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38745
Entity Detected:Scrt2, ( MGI:2139287)
Sequence:sense strand is shown

>T38745
GTGTGTCCCCATACCGTAATCTAATCTTCACCACTCTTGGAGTCCTCTGCCTGTCCATTCCTGAGCCCCT
CCATGCTTGGGCCTTAGGTCCAGCCTCTTACACACACGATTCCACCTGACATTATCAGTCCTCCCGGATC
TCATCAGACATCCTGCTCTCTCCAGCTCCATCTTCCCACTAGTAGCTCCCAGTCCTCAGTTTTCCTAGCT
GGGAACAGACTTGGGAGGCAGCCCAAGGCTCTGCCCTCTCAGGTGACCCCTCTTGCCCCAGGAAAGTTCC
TGTCTAGGCCTCAGGCCTGGAGCTGCGATTTCCCAGACTATCTGAGCACTTTCCCTCGCCCCAGGACTAC
AGGTTCGCCTCTGCCTTTGCTAGAGAACAGCCTGGAGCACCTCACCCATGGACACATCCCCTCGTCCGGC
AGGGCCCCTTCCGCTATTTATTTGTGTATTTATTTATTTATCTATTTATTATTCTATTTAATCTCTTGGC
TTCACCCAGGGACTGTCTGGCTTCCCCAGCTGGACTGGGAAGTCAAAGGGTAGAGTCAGCAAGGCCGTCC
GTCGCTGGCTGCTCCTCCCCTTATGGGTCTGGGGAGAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163377. Forward Primer - name:163377_F_cDNA_mCG13184.2, sequence:GTGTGTCCCCATACCGTAATCT; Reverse Primer - name:163377_N_SP6_cDNA_mCG13184.2, sequence:GCTTCTCCCCAGACCCATAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016519 same experiment
 EMAGE:32208 same embryo
 EMAGE:31915 same embryo
 EMAGE:32205 same embryo
 EMAGE:32234 same embryo
 EMAGE:32235 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS