Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31980

Scrn1 ( MGI:1917188)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980
euxassay_012592_01 euxassay_012592_02 euxassay_012592_03 euxassay_012592_04 euxassay_012592_05
EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980
euxassay_012592_06 euxassay_012592_07 euxassay_012592_08 euxassay_012592_09 euxassay_012592_10
EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980
euxassay_012592_11 euxassay_012592_12 euxassay_012592_13 euxassay_012592_14 euxassay_012592_15
EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980 EMAGE:31980
euxassay_012592_16 euxassay_012592_17 euxassay_012592_18 euxassay_012592_19 euxassay_012592_20
EMAGE:31980
euxassay_012592_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 10 11
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 14 15 16 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 13 14
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 14 15 16
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 10 11
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 06 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12
midbrain floor plate
moderate moderate
regionalmoderate expression: see section 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 14 15 16 17 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 08 09 10 11 12 13 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 12 13 14 15
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 15 16 17 18 19 20 21
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 14 15 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 06 07 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 08 09 10 11 12 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 01 19 20 21
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
pons marginal layer
moderate moderate
regionalmoderate expression: see section 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15
diencephalon lateral wall marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
glans of male genital tubercle
moderate moderate
regionalmoderate expression: see section 09 10
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31553
Entity Detected:Scrn1, ( MGI:1917188)
Sequence:sense strand is shown

>T31553
ATGCCCACTCCTGCCATAGCTTCCAAAGTGCATATCTGCTGGTGGACCGAGATGAAGCCTGGGTGCTGGA
GACTGTAGGGAAGTATTGGGCTGCTGAGAGAATCACAGAGGGAGTGAGGTGCATTTGCAACCATCTTTCC
CTCGCGACTAAGCTGGATGAAGAGCACCCAGAACTCAGGACTTATGCTCAGAGTCAAGGCTGGTGGACGG
GAGACGACGAATTCAACTTTGCCCAGGTTTTTTCTCCAGCCGATGACCGTTTGGACTGCTGTGCAGGCCA
AGACAGCTTAGAAAAGCAAGAAGAAAGCATCACTGTGCAGACGATGATTAACATCTTACGAGACAAAGCC
AGTGGTGTTTGCATAGATTCTGAGTCTTTCCTCACCACAGCCAGTATAGTGTCTGTCTTGCCTCAGAACA
GAAGTTCACCGTGTATCCACTACTTCACCGGGACCCCAGATCCTTCCAGGTCCATATTCAAGCCTTTCAT
CTTTGTTGATGATGTAAAACTTGTCCCCAAAGCACAGTCACCCTGTTTTGGTGACGATGACCCAGCCAAA
AAGGAACCTCGGTTCCAGGAGAAGCCAGACCGCCGACATGAGCTGTACAAGGCACACGAGTGGGCACGTG
CTGTCATCGAGAGTGACGAGGAGCAAGGTCGCACCCTGAGGAAGACCATGCTGGAGTTGGAGAAGCAAGG
CCTGGAGGCCATGGACGAGATTCTGAGCAGCCCCGAGCCCCCGGACCCCGCCGAGGTGGGGGACCTATTC
TATGACTGTGTGGACACCGAGATGAAGTTCTTTAAGTGATGTAAGCACCCTCACCCTTACTCAAAACTTC
CCACCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5252046), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 31104. Forward Primer - name:031104_F_IRAV67-70_N13_Scrn1, sequence:ATGCCCACTCCTGCCATA; Reverse Primer - name:031104_R_SP6_IRAV67-70_N13_Scrn1, sequence:TCGGGTGGGAAGTTTTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012592 same experiment
 EMAGE:30659 same embryo
 EMAGE:30548 same embryo
 EMAGE:31982 same embryo
 EMAGE:31984 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS