Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32119

Cadps ( MGI:1350922)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119
euxassay_006311_01 euxassay_006311_02 euxassay_006311_03 euxassay_006311_04 euxassay_006311_05
EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119
euxassay_006311_06 euxassay_006311_07 euxassay_006311_08 euxassay_006311_09 euxassay_006311_10
EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119
euxassay_006311_11 euxassay_006311_12 euxassay_006311_13 euxassay_006311_14 euxassay_006311_15
EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119 EMAGE:32119
euxassay_006311_16 euxassay_006311_17 euxassay_006311_18 euxassay_006311_19 euxassay_006311_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 03 weak expression: see section 02
metencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain meninges
moderate moderate
regionalmoderate expression: see section 13
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 07 13
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
thoracic ganglion
weak weak
regionalweak expression: see section 09 11
medulla oblongata lateral wall
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain lateral wall
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 03 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 15
spinal cord lateral wall
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 06 07 15 16 17 18 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 14 15 16 17 18 19 weak expression: see section 11 12 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 14 15 18 weak expression: see section 08 09 10 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 06 07
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 03 04 05 06 07 08 09 11 12 13 17 18 19 20
diencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35008
Entity Detected:Cadps, ( MGI:1350922)
Sequence:sense strand is shown

>T35008
AGCGATGAGGAAGATGAAGAAGAAGATTAGACCATTCTCTGGGTCCAAGAGTCCATTGGGATGGAGTCCT
GTAATCAATGCATGTCTTTAGTCTGTTAGTTAACCCCATTAGGTAATTTTCTGTCAACCACCATCCCCAT
GAGATGTTTACCAATACAATTACCATTTTAGCTGCGTGGTACCAAGATTAGCAAATGGTTTCCTGATTTC
TGTGTCTATATGTTTACAAGCAATATGGAACACCATTCTTAAACACTGTTCATGGAAAGAATACATAGTT
CAGCTGCTAGGTGTGTCCCTTTTGTTAGCAGAACAAAATGATGCTTCATCCTGTACTACAGATACACGGA
TTGGAAGTGGACATGGAAGCAAGTGTGTTTCCATGTCTCTGTTTCATGTATGTGGGTACCAGGTATTTAA
ATTAGTACATAAATTAATTTAAGTGCATAGAGCTGCTTGGTTTTGGTCTCTGTTTTGTTCTTGTTTTATG
AGAAGGGGAAAAGGCATGGTCCCAACAACCAACTTTAGCTTTTCTCATCCCCTAAAACTAAAAGCAATGG
ACCACTTGTGTCCCAGCAAACCCAGCTTTGCATTTATCCATGTAGTTTAGTTCCCCCTACCAAAAAAGTT
ACATATCAATGGATTAATTATTTTCATTGTCATAGCAAGGGGGCCACGTGATCAGGAAGTAGCATCAAGT
AAGTTTCAGACCAACTGTCTTCTGTGAAAGTTTATCCTAGTAAATGTCACATTTTGCTTTTCTGTTTCAA
TAACTGTATATGTAAAAAAAATTATTGAAATGAAAACCCTAGACTATAAATGTATTTATAATAAGATATG
GATATTTCCTTCAGTAGACTGTAACCATAACTTCAATTATTTTGTTCCACACTGTTTTTTATATCTGTCA
TGTACATTGCACTTTGATCTGTAACTGAGCGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50070. Forward Primer - name:050070_F_cDNA_Cadps, sequence:AGCGATGAGGAAGATGAAGAAG; Reverse Primer - name:050070_N_SP6_cDNA_Cadps, sequence:GTCGCTCAGTTACAGATCAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006311 same experiment
 EMAGE:30713 same embryo
 EMAGE:31549 same embryo
 EMAGE:30449 same embryo
 EMAGE:30465 same embryo
 EMAGE:31551 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS