Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6715

Armcx1 armadillo repeat containing, X-linked 1 ( MGI:1925498)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715
"Pseudo-wholemount" of euxassay_002320. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002320_01 euxassay_002320_02 euxassay_002320_03 euxassay_002320_04
EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715
euxassay_002320_05 euxassay_002320_06 euxassay_002320_07 euxassay_002320_08 euxassay_002320_09
EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715
euxassay_002320_10 euxassay_002320_11 euxassay_002320_12 euxassay_002320_13 euxassay_002320_14
EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715 EMAGE:6715
euxassay_002320_15 euxassay_002320_16 euxassay_002320_17 euxassay_002320_18 euxassay_002320_19
EMAGE:6715 EMAGE:6715 EMAGE:6715
euxassay_002320_20 euxassay_002320_21 euxassay_002320_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6715Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6715_wholemount_strong.wlz
6715_wholemount_moderate.wlz
6715_wholemount_weak.wlz
6715_wholemount_possible.wlz
6715_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6715_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 19 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 07 16
spinal cord
weak weak
homogeneousweak expression: see section 07 08 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3406
Entity Detected:Armcx1, armadillo repeat containing, X-linked 1 ( MGI:1925498)
Sequence:sense strand is shown

>T3406
GGCAAACCTCAAGATGACTCAAAGTCCAAGGTTGAGGTGAATGTGGGACCTGAGAATGGTCCAGGTGTAA
AGAAAGAAGTGCACCCAGAATCCCAGAGTGGGGGTGGACTAGAGGCTAAGGCCAAGGCCCTTTTCAAGAC
TCTAAAGGAACAGGCACGTGCAAAGGCAGGCAGAGGCATAAGGCTTCCTAACATCTCTAGGAATAGGACC
CTGACATCAAGTTTGCCTTGCCCAGGAGGCAGGGGTGGAGGCTGCCACCCGGGAAGGACTGGTTCTAGGG
CTAGGAACAGGACAAGTGGGAAAGTCAAGAGAAAGAACCGAAGCAAGAGCAACAAGGCTCCAGCCACAGC
ATGGCCTGTACGCAAGGGCAAGTTCAGCTTTCCCTATAAAATTGATGATATTCTGAGCGCCCCTGATCTT
CAAAAGGTCCTGAACATCCTGGAGAGAACAAATGACCCTTTTACTCAGGAAGTAGCACTGGTCACACTGG
GTAACAATGCAGCATATTCATTTAATCAA
Notes:The probe template was PCR amplified from IMAGE:3025588 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3025588 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6713 same embryo
 EMAGE:6714 same embryo
 EMAGE:6718 same embryo
 EMAGE:6716 same embryo
 EMAGE:6717 same embryo
 EurExpress:euxassay_002320 same experiment
 MGI:4823249 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS