Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6837

1810009A15Rik RIKEN cDNA 1810009A15 gene ( MGI:1913526)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837
"Pseudo-wholemount" of euxassay_002644. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002644_01 euxassay_002644_02 euxassay_002644_03 euxassay_002644_04
EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837
euxassay_002644_05 euxassay_002644_06 euxassay_002644_07 euxassay_002644_08 euxassay_002644_09
EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837
euxassay_002644_10 euxassay_002644_11 euxassay_002644_12 euxassay_002644_13 euxassay_002644_14
EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837 EMAGE:6837
euxassay_002644_15 euxassay_002644_16 euxassay_002644_17 euxassay_002644_18 euxassay_002644_19
EMAGE:6837 EMAGE:6837 EMAGE:6837
euxassay_002644_20 euxassay_002644_21 euxassay_002644_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6837Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6837_wholemount_strong.wlz
6837_wholemount_moderate.wlz
6837_wholemount_weak.wlz
6837_wholemount_possible.wlz
6837_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6837_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 15
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 weak expression: see section 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 06 07 08
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5035
Entity Detected:1810009A15Rik, RIKEN cDNA 1810009A15 gene ( MGI:1913526)
Sequence:sense strand is shown

>T5035
GAATGAGCCGCGGAGTGTAGCCATGGCACCTCCGGGAGGAAAGATCAATCGTCCCCGGACGGAGCTGAAG
AAGAAGTTGTTCAAGCGCCGCAGGGTATTAAGCAGGGATCGGCGACGGAAACGCCAGGTGGTCGGGGCTG
TGATAGACGAAGGGCTGACTACGAAGCACCACCTCAAGAAGCGGGCGTCCAGTGCTCGTGCCAACATCAC
GCTGTCTGGGAAGAAGCGCAGGAAACTCTTGCAGCAGATCCGACTTGCCCAGAAAGAAAAAGCAGCCATG
GAAGTGGAAGCCCCCTCCAAGTCAACCAGGACTAGTCAGCCACAGCCCAAGCAACAAAAGAAGATAAAAG
CTCCCCAGGACGTAGCTATGGAGGATCTTGAAGATAAGAGCTAAAATCCCTGCCTCTTCTACCAGAAGAT
GGTCAACAGCACTGAGAAAGATTTGGAGGAACTTTGGAAAAAATATTAGCATATTTCACTTTCCTAGACA
CCTCTTCTACAGCGGACCCTGACCTCCCCTGGAGGTGTATATTGGGACCGAAGAGGACACAGAGAAAGAC
TGGAGGGCCACCTCTAGCAGTCAACTCCTTTTGTAATAAAGCTTTAGTGCGTTCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5253822 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5253822 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6836 same embryo
 EMAGE:6841 same embryo
 EMAGE:6840 same embryo
 EMAGE:6839 same embryo
 EMAGE:6838 same embryo
 EurExpress:euxassay_002644 same experiment
 MGI:4822634 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS