EMAGE mouse gene expression spatial database

EMAGE:6945

Apoc4 apolipoprotein C-IV ( MGI:87878)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_004544. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_004544_01	euxassay_004544_02	euxassay_004544_03	euxassay_004544_04

euxassay_004544_05	euxassay_004544_06	euxassay_004544_07	euxassay_004544_08	euxassay_004544_09

euxassay_004544_10	euxassay_004544_11	euxassay_004544_12	euxassay_004544_13	euxassay_004544_14

euxassay_004544_15	euxassay_004544_16	euxassay_004544_17	euxassay_004544_18	euxassay_004544_19

euxassay_004544_20	euxassay_004544_21	euxassay_004544_22	euxassay_004544_23	euxassay_004544_24

euxassay_004544_25	euxassay_004544_26

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T7429
Entity Detected:	Apoc4, apolipoprotein C-IV ( MGI:87878)
Sequence:	sense strand is shown >T7429 GAGGGACAGAGATAGAGAGGGACCAAGTCCCCAGAAATGTCCCTGCTGAGGTGCAGGCCACGGGACCTGC CATCAGTCTCCCTTTCTGTGCTGTTCTTGGTCAGCTTTGTAGCATCCATGTCTACAGAAAGCCTGAGCCC CACGCCTGGCCCTGAGAGCAGCCGCTGGAGCCTGGTAAGGGCCAGGGTGTTGGAGATGGTGGAGCCACTG GTGACCAGAACCAGGGACAGATGGCAGTGGTTCTGGGGCCCTGGAGCTGTCCAGGGCTTTATGCAGACCT ACTATGAAGATCACCTGAAAGACCTGGGTCCCCGAACTCAGGCCTGGCTGCAGAGCTCCAGAGACCACCT CCTAAACAAGACCCACAGCCTGTGTCCCAGACTGCTCTGCAAAGACCGGACTCAGGGTTAAAGTGCCACG TACCTCCCTCCCCTGGCACCCACAATAAAGGTGTTTGTTCTTGAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:4196217 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4196217 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6943 same embryo
	EMAGE:6942 same embryo
	EMAGE:6944 same embryo
	EurExpress:euxassay_004544 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source